ID: 1038562969

View in Genome Browser
Species Human (GRCh38)
Location 8:28596491-28596513
Sequence CCCCTGTGTGGCTGGGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038562963_1038562969 -6 Left 1038562963 8:28596474-28596496 CCGATGGCGGGAAAGTCCCCCTG No data
Right 1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG No data
1038562961_1038562969 0 Left 1038562961 8:28596468-28596490 CCCTATCCGATGGCGGGAAAGTC No data
Right 1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG No data
1038562960_1038562969 1 Left 1038562960 8:28596467-28596489 CCCCTATCCGATGGCGGGAAAGT No data
Right 1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG No data
1038562962_1038562969 -1 Left 1038562962 8:28596469-28596491 CCTATCCGATGGCGGGAAAGTCC No data
Right 1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038562969 Original CRISPR CCCCTGTGTGGCTGGGTCCG AGG Intergenic
No off target data available for this crispr