ID: 1038565242

View in Genome Browser
Species Human (GRCh38)
Location 8:28614561-28614583
Sequence CAAAGTAAACAGAAGAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 506}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038565242_1038565247 22 Left 1038565242 8:28614561-28614583 CCCCAGTTCTTCTGTTTACTTTG 0: 1
1: 0
2: 1
3: 45
4: 506
Right 1038565247 8:28614606-28614628 TTTTCCTGAGGTGGAAGCTTAGG No data
1038565242_1038565245 10 Left 1038565242 8:28614561-28614583 CCCCAGTTCTTCTGTTTACTTTG 0: 1
1: 0
2: 1
3: 45
4: 506
Right 1038565245 8:28614594-28614616 GCTGTTTTTAAATTTTCCTGAGG No data
1038565242_1038565246 13 Left 1038565242 8:28614561-28614583 CCCCAGTTCTTCTGTTTACTTTG 0: 1
1: 0
2: 1
3: 45
4: 506
Right 1038565246 8:28614597-28614619 GTTTTTAAATTTTCCTGAGGTGG No data
1038565242_1038565249 29 Left 1038565242 8:28614561-28614583 CCCCAGTTCTTCTGTTTACTTTG 0: 1
1: 0
2: 1
3: 45
4: 506
Right 1038565249 8:28614613-28614635 GAGGTGGAAGCTTAGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038565242 Original CRISPR CAAAGTAAACAGAAGAACTG GGG (reversed) Intronic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
902489641 1:16771931-16771953 ACAAGTAAATAAAAGAACTGTGG - Intronic
903366788 1:22810316-22810338 CACAGGAAACAGGAGAACAGTGG - Intronic
903903730 1:26668229-26668251 CAAAAAAAAAAGAATAACTGAGG - Intergenic
905525511 1:38635497-38635519 CAATTTAAAGAGAAGGACTGAGG - Intergenic
906198296 1:43943403-43943425 AAAACCAAACAGAAGAGCTGAGG + Intergenic
906311276 1:44756344-44756366 CAAAGAAAACACAAGAAGCGAGG - Intronic
907119102 1:51992967-51992989 GAAAGCAACCAGAAGAACTGAGG - Intergenic
908037903 1:60075353-60075375 CAAAGTGAACAAAGGCACTGAGG - Intergenic
908111199 1:60899553-60899575 CAAAATAAAGACAATAACTGAGG - Intronic
908483808 1:64570571-64570593 AACTGCAAACAGAAGAACTGGGG - Intronic
909822721 1:80086386-80086408 CAAACTATAAAGAAGAACTAAGG + Intergenic
910015234 1:82515746-82515768 CAAAGTTGACAGCAGCACTGTGG + Intergenic
910182454 1:84500497-84500519 TAAAGTGAATACAAGAACTGAGG + Intronic
912019678 1:105091501-105091523 AAAAGTAAACTGAAGAACTAGGG + Intergenic
912243973 1:107941590-107941612 CAAACAAAACAGAAGTACTGAGG - Intronic
912425117 1:109581302-109581324 TTCAGTAAACAGAAGAGCTGGGG - Intronic
913562642 1:120037563-120037585 CCAAACAAACAGAAGAAGTGCGG + Intronic
913635480 1:120756044-120756066 CCAAACAAACAGAAGAAGTGCGG - Intergenic
914283238 1:146196944-146196966 CCAAACAAACAGAAGAAGTGCGG + Intronic
914312957 1:146483971-146483993 TCATGAAAACAGAAGAACTGCGG + Intergenic
914501393 1:148249404-148249426 TCATGAAAACAGAAGAACTGCGG - Intergenic
914544268 1:148647664-148647686 CCAAACAAACAGAAGAAGTGCGG + Intronic
914622365 1:149423348-149423370 CCAAACAAACAGAAGAAGTGCGG - Intergenic
914746506 1:150505345-150505367 CAAAGTCCACGGAATAACTGGGG + Intronic
915540026 1:156559767-156559789 GAATGTGAACAGAAGAGCTGGGG + Intronic
915738489 1:158099760-158099782 AAAAGCAAACAGAAGAGCTCAGG - Intronic
915865208 1:159492160-159492182 GAAAGTAAACAACACAACTGAGG - Intergenic
916192203 1:162190789-162190811 AAAAGTAAAAAGCAGAACAGCGG - Intronic
916563567 1:165954080-165954102 AAAAGTAAAGAGAAGATCTTAGG - Intergenic
916572886 1:166042460-166042482 AAAAGAAAAAAGAAGAACAGAGG - Intergenic
916943671 1:169702390-169702412 CAAAGTAATGGGAAGAACTAAGG - Intronic
917616643 1:176752642-176752664 AACAGTAAACTGAAGAACAGAGG - Intronic
917886795 1:179394139-179394161 AAAAGGAAACAGAAGAACCTTGG - Intronic
918889919 1:190253762-190253784 CAAATTAAACTAAAGAACTTCGG - Intronic
919481902 1:198100277-198100299 CAAAGGAAAGGGAAAAACTGGGG + Intergenic
919690665 1:200525877-200525899 AAAAGAAAAAAGAAGAACTACGG + Intergenic
919972009 1:202587054-202587076 CAAAATAAGCAGATGAATTGGGG - Exonic
920707007 1:208258878-208258900 CAGAGAAAACTTAAGAACTGTGG - Intergenic
921765306 1:218965477-218965499 CAAAGTAGAGAATAGAACTGAGG - Intergenic
922038459 1:221872895-221872917 CAAAGAAAAGAGAGGAACTGAGG - Intergenic
922454090 1:225760590-225760612 CAAAAGAAAGAGAAGAAATGTGG - Intergenic
922884760 1:229009639-229009661 AAAAGAAAAAAGAAGAAATGAGG + Intergenic
923231487 1:231990531-231990553 CCAAGTACACAGAAGCAGTGAGG - Intronic
923530797 1:234810598-234810620 ACAAGTAAATAAAAGAACTGTGG + Intergenic
924413959 1:243837928-243837950 GAAAGGAAAAAGCAGAACTGTGG + Intronic
1063229668 10:4052114-4052136 CAAACTCAACACAAGAGCTGGGG - Intergenic
1063242332 10:4183947-4183969 CTAAATAAACAGCAGAAATGTGG - Intergenic
1063330027 10:5148273-5148295 GAAAGTAAAAATAAGAAGTGGGG + Intergenic
1063408478 10:5818152-5818174 CAAAGTATCAAGAGGAACTGGGG - Intronic
1063821209 10:9838509-9838531 CAAAGTAAGCTGAAAACCTGTGG + Intergenic
1064161873 10:12953501-12953523 AAAGGAAAACAGAAGATCTGTGG + Intronic
1064618904 10:17194033-17194055 CAAAGTAGACAAAAAAAATGGGG + Intronic
1064823521 10:19367294-19367316 AGAAGTAAACAGTAGAACAGAGG - Intronic
1065121596 10:22536095-22536117 TAATGTAAACAGTAAAACTGAGG + Exonic
1065413844 10:25462535-25462557 CAAAGTAAACTGAAAACCTCTGG + Intronic
1066009289 10:31179428-31179450 CAGAGTAAGAAGAAGAACCGTGG - Intergenic
1066071705 10:31822193-31822215 CAAAGAAAACAGAATTATTGTGG + Intronic
1066318395 10:34273255-34273277 CAAAAAAAACAAAAAAACTGGGG + Intronic
1068262422 10:54600011-54600033 CAAAGTCAAAAGCAGAAGTGGGG + Intronic
1068633898 10:59327238-59327260 GAAAGAAGACAGAAGAAATGGGG + Intronic
1068795723 10:61077639-61077661 CAAGGAGAACAGCAGAACTGAGG - Intergenic
1071396994 10:85233897-85233919 CAAAGGAAACAGAGGAACTTGGG - Intergenic
1072320221 10:94242265-94242287 CAAAAAAAACACAAGATCTGGGG - Intronic
1072347824 10:94526116-94526138 AAAAGTAAAAAGTAGAACAGAGG - Intronic
1073284044 10:102376534-102376556 TAAAGTACACAGAGGAGCTGGGG - Intronic
1074393438 10:113077152-113077174 GAAAGAAAACAGAAGCTCTGTGG + Intronic
1075380854 10:122017400-122017422 CAAAGGAAGGAGAAGAACTAGGG - Intronic
1075909466 10:126111780-126111802 CATAATAAAGAGAAGCACTGGGG + Intronic
1076019421 10:127059492-127059514 ATAACTAAACAGAAGTACTGAGG - Intronic
1078054253 11:7994387-7994409 CAAAGTAAACAGATGGCCTTGGG - Intronic
1078347725 11:10565806-10565828 CAAAAAAAAAAAAAGAACTGGGG - Intronic
1078395698 11:10980136-10980158 GAAACTCAACAGAAGGACTGAGG - Intergenic
1078959740 11:16250512-16250534 CAAAGTAAACAAGATAAGTGGGG + Intronic
1079197417 11:18342187-18342209 CAGAGTAAAGGGAATAACTGAGG - Intronic
1079584358 11:22107404-22107426 CAAAGCAGGCAGAAGAAGTGGGG + Intergenic
1081029657 11:38063012-38063034 GAATGTGAACAGGAGAACTGTGG - Intergenic
1081328297 11:41773177-41773199 CAAAGGACACAGAATAACTAAGG + Intergenic
1081497346 11:43628450-43628472 CAAAGTAACCTGAAAAATTGGGG - Intronic
1083278865 11:61613197-61613219 CAAAGGAAACCCAAAAACTGTGG + Intergenic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1086103143 11:83122452-83122474 CAAAGAAAATAGAAGGGCTGGGG - Intergenic
1087063974 11:94010258-94010280 CACAGTGAAAAGAAGAACAGAGG - Intergenic
1087122859 11:94592958-94592980 CCAAGCAAATAGAAGAGCTGGGG + Intronic
1088031145 11:105252239-105252261 AACAGTAAGCAGAAGATCTGGGG + Intergenic
1088144995 11:106665828-106665850 GGAAGTAAAGAGTAGAACTGTGG - Intergenic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1090122461 11:124046492-124046514 GAAAGTAAAGAGTAGAACTGTGG + Intergenic
1090150859 11:124382680-124382702 CAATGAAAACATAAGAAATGAGG + Exonic
1090152148 11:124396688-124396710 CAATGAAAACATAAGAAATGAGG + Exonic
1090655409 11:128839893-128839915 CAGAGAAAACAGAAAAGCTGAGG + Exonic
1090661972 11:128889257-128889279 TAAAGAGAACAGAAGAAGTGAGG + Intergenic
1093315301 12:17642689-17642711 CAAAGTATAAAGAAAAATTGGGG - Intergenic
1093437514 12:19152314-19152336 CAAAGTAAGCAGGACAACAGTGG + Intronic
1093598817 12:20996526-20996548 CTAAGCAAACAGAAGAAATCTGG - Intergenic
1093640224 12:21519358-21519380 TACAGGTAACAGAAGAACTGAGG - Intergenic
1094667367 12:32534165-32534187 CAAAGTAAAGTAAACAACTGAGG - Intronic
1095159281 12:38897873-38897895 CAAAGCAAATATAAGAACTGGGG + Intronic
1095604297 12:44048602-44048624 CAAAATAAAGGGCAGAACTGAGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097521800 12:60679574-60679596 AAAAGTAAGCAAAAGAACTCCGG - Intergenic
1097773094 12:63612645-63612667 CAAAGTAAGCAAAAGAAATGAGG + Intronic
1098288764 12:68934660-68934682 TAAAGAAAAAAAAAGAACTGAGG + Intronic
1098719873 12:73882726-73882748 CTAAGTACACTGAAGAACTTGGG - Intergenic
1098769710 12:74537918-74537940 CAAAACAAACAGAAGGACTTGGG + Exonic
1098822941 12:75255821-75255843 AAAAGGAAATAGAAGAAATGGGG - Intergenic
1099634733 12:85199377-85199399 CAAAGTCAACAAAAGCAATGGGG - Intronic
1099848745 12:88063911-88063933 AAAAGTAAACATAACAACTAAGG + Intronic
1100082261 12:90866730-90866752 CAACCTGAACAGAAGAGCTGGGG - Intergenic
1100769406 12:97905150-97905172 CAAAATAAATATAATAACTGTGG - Intergenic
1100866389 12:98861798-98861820 CACAGTTAACAGAAAAACTGGGG + Intronic
1101397332 12:104359846-104359868 CTAAGAAAACAGAGGTACTGGGG - Intergenic
1101682042 12:106978567-106978589 CAAAGAAAATACAAGAACAGTGG - Exonic
1102318878 12:111913601-111913623 GAAAATAAACAAATGAACTGAGG - Intergenic
1102327721 12:112002602-112002624 CACAGTAAATAGAAGAGCAGGGG - Intronic
1102892616 12:116572361-116572383 CAAAAAAAAAAAAAGAACTGAGG - Intergenic
1102972928 12:117185013-117185035 CAATGTAAACAGAGGGAATGGGG + Intronic
1103919999 12:124394383-124394405 GAAAGTACACAGAAGAGCTGAGG - Intronic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1105028070 12:132862884-132862906 AAAAGAAAACAAAAGAAATGAGG - Intronic
1107272581 13:38637810-38637832 CAAAGTATACAGAAGAAGCATGG + Intergenic
1108084083 13:46766814-46766836 CCAAGTAATCTGAAGAATTGGGG - Intergenic
1108093760 13:46879198-46879220 CAAGGTTAACACAAGAGCTGTGG + Intronic
1108461739 13:50673911-50673933 AAAAGAAAAAAGAAAAACTGTGG - Intronic
1108759626 13:53546673-53546695 GAAAGAAAAGAGATGAACTGAGG + Intergenic
1109265912 13:60200158-60200180 CAATGTAAACTGATCAACTGAGG - Intergenic
1109633435 13:65083262-65083284 CAAAGAAAACTGAACATCTGAGG - Intergenic
1109933252 13:69244792-69244814 GAAAGTGAACAGAACAACAGTGG - Intergenic
1110421083 13:75310015-75310037 GAAAGAAATCAAAAGAACTGAGG - Exonic
1112545955 13:100370977-100370999 AAAATTAAACAGAAGAACTCTGG - Intronic
1112999721 13:105620057-105620079 CATAGTAATGAGAAGGACTGGGG + Intergenic
1113494682 13:110717406-110717428 TAGAGTAAACATAAGAACTCAGG - Intronic
1115955227 14:38770696-38770718 CAGAATAAACAGTACAACTGAGG + Intergenic
1116692926 14:48134333-48134355 AAAAATAAACAGATAAACTGTGG + Intergenic
1116809605 14:49526513-49526535 CAAAGTAAAAGGAGGAATTGAGG + Intergenic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1118006339 14:61567450-61567472 AGAAGTAAACAGTAGAACAGAGG - Intronic
1118681666 14:68248178-68248200 AAGAGTAAACAGAAAAAATGTGG - Intronic
1118767257 14:68918125-68918147 CAAAGGAAACGGGAAAACTGAGG + Intronic
1119706453 14:76785749-76785771 CAAACTTAACAGAAGTGCTGTGG + Intergenic
1120006533 14:79364165-79364187 GACAGAAAAAAGAAGAACTGGGG - Intronic
1121043334 14:90768641-90768663 CCAAGTAAACACAAAAGCTGAGG + Intronic
1122805850 14:104256533-104256555 TAAAGAAAAGAAAAGAACTGGGG - Intergenic
1125133536 15:36313205-36313227 CACAGTAATCATAAGCACTGAGG + Intergenic
1125349271 15:38750820-38750842 AAAAGTAAAGAGAAGAAATAAGG + Intergenic
1126075782 15:44907832-44907854 CAAAGTAAACAGAAAAAAAAAGG + Intergenic
1126436295 15:48641884-48641906 CAAATTTAACATAAGAATTGGGG + Intronic
1126504306 15:49386099-49386121 GAAAGTCAACAGAGGAACAGTGG + Intronic
1126615351 15:50573385-50573407 CAGAGAACACTGAAGAACTGAGG + Intronic
1126659483 15:51018203-51018225 GGAAGTAAACAGTAGAATTGTGG - Intergenic
1127050536 15:55078944-55078966 CAAAGCAAAAAGAAGAAATCTGG + Intergenic
1127466403 15:59248700-59248722 GAAAGTAAACAGCAGAGATGGGG + Intronic
1127886719 15:63207870-63207892 CAAATTGTACATAAGAACTGAGG - Intronic
1128183036 15:65621755-65621777 CAAAGTCAATGGAGGAACTGGGG - Intronic
1128267142 15:66276904-66276926 CAAAGAAACCACAGGAACTGAGG + Intergenic
1128738108 15:70065038-70065060 CATAGCAGACAGGAGAACTGGGG - Intronic
1128822906 15:70677385-70677407 AAAAGTAGACAGAAGATATGAGG - Intronic
1129030950 15:72617207-72617229 CCAAGGAAAAAGAAGATCTGGGG - Intergenic
1129648177 15:77457632-77457654 CAAACAAATCACAAGAACTGAGG - Intronic
1130414456 15:83678995-83679017 TAAAATAAACAGAACATCTGAGG - Intronic
1130510373 15:84584018-84584040 CCAAGGAAAAAGAAGATCTGGGG + Intergenic
1130584555 15:85171020-85171042 CCAAGGAAAAAGAAGATCTGGGG - Intergenic
1130790306 15:87147883-87147905 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1131617765 15:94034503-94034525 AAAAAAAAAAAGAAGAACTGTGG + Intergenic
1132168035 15:99615735-99615757 CAAACCAAACAGAATGACTGAGG + Intronic
1132849290 16:2017301-2017323 CAAACAAAACAGAAGGTCTGGGG - Intronic
1133146019 16:3787210-3787232 CACAGTGAAGAGAAGCACTGAGG + Intronic
1133982402 16:10642793-10642815 AGAAGTAAACAGTAGAACAGAGG + Intronic
1134535592 16:15024398-15024420 AAAAATAAACAGAAGAATTGGGG - Intronic
1135514221 16:23116222-23116244 CAAAAAAAACAGAAGAACTCAGG + Intronic
1137337750 16:47567032-47567054 CAAAGCAAAAAGAAGAAATCTGG - Intronic
1138906903 16:61347449-61347471 CAATGAAACCAGAAGAAATGAGG + Intergenic
1139203957 16:65007191-65007213 CAAAGGAAACAGAAAGACTTGGG - Intronic
1139400715 16:66679375-66679397 CCAAGGAGAAAGAAGAACTGAGG + Intronic
1139860449 16:70016379-70016401 AAAAATAAACAGAAGAATTGGGG + Intergenic
1140575748 16:76166444-76166466 CAAAGTCCACTGAAGGACTGAGG + Intergenic
1141013436 16:80425032-80425054 AAAAGCAAAGAGAAGAACAGGGG + Intergenic
1141349504 16:83280621-83280643 CAAAGTAAACTGAAAACCTTCGG - Intronic
1142953195 17:3501240-3501262 CAAAGTAAACAGAAAACCTCTGG + Exonic
1142953816 17:3506420-3506442 CAAAGTCAACCAAAAAACTGAGG + Intronic
1143428267 17:6858093-6858115 CAAAGTCAACAAAAGCAGTGAGG - Intergenic
1144163607 17:12585634-12585656 CAAAGGAAACTGAACAAATGTGG + Intergenic
1144706949 17:17375348-17375370 CAAAGTAAACTGAAAACCTTTGG + Intergenic
1145228805 17:21155037-21155059 CACAGTGGGCAGAAGAACTGTGG + Intronic
1145358365 17:22184980-22185002 TGAATTAAACAGAAGAAATGAGG + Intergenic
1146141146 17:30369022-30369044 CAAAGCAAGCAGCAGAACTTAGG + Intergenic
1146407829 17:32554405-32554427 CAAAGATAACTGAAGAAGTGTGG - Intronic
1147424116 17:40337605-40337627 CAAATTAAGAATAAGAACTGTGG - Intronic
1147765518 17:42833252-42833274 TAAAGTAAAAAGGAGAGCTGTGG - Intronic
1148825883 17:50393811-50393833 CAAAGTGTACAGAAGGAGTGCGG + Intronic
1149150383 17:53555310-53555332 GAAAGCAAACAGATGAACTTTGG - Intergenic
1149326194 17:55532118-55532140 GAAAGTTAACAGCAGAAATGAGG - Intergenic
1149635457 17:58164938-58164960 AGAACTAAAGAGAAGAACTGAGG - Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1150642692 17:66960299-66960321 CAAAGTAAAGTGAAGAATTGAGG + Intergenic
1151793233 17:76323409-76323431 CAAAGTAAACTGAAAATCTCTGG + Intronic
1151996256 17:77611150-77611172 GAAAGAAAACAACAGAACTGCGG - Intergenic
1152101874 17:78306253-78306275 CAAAGTAACCAGAATACCTTGGG + Intergenic
1152283849 17:79401184-79401206 CAAAGGAAAGATAAGAACTTCGG + Intronic
1153188626 18:2513890-2513912 CAAAGTAAACAGAATGTCTGGGG - Intergenic
1153559656 18:6359225-6359247 CAAAGTAGACAGATCAACTGAGG + Intronic
1154096337 18:11418821-11418843 CTATGTATACAAAAGAACTGTGG - Intergenic
1154491278 18:14924195-14924217 TAAAATGAACAGTAGAACTGTGG + Intergenic
1155374255 18:25138746-25138768 AAAAGGAAACTGAGGAACTGAGG + Intronic
1156628061 18:38933702-38933724 ACAAGTAAAGAGAAGAAATGGGG + Intergenic
1156791943 18:40986107-40986129 CAAAATAAAAAGAAGAACTACGG + Intergenic
1158008417 18:52699815-52699837 CAAGGAAAACAAAAGAATTGGGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158457465 18:57621165-57621187 TAAAGGAAACAGAAGCTCTGAGG + Intronic
1158643329 18:59221002-59221024 CAAAGCGAAGAGAAGGACTGAGG - Intronic
1159479431 18:68968724-68968746 AGAAGTAAACAACAGAACTGTGG - Intronic
1160218016 18:76950760-76950782 CAAAGTAAAGTGAAAATCTGTGG - Intronic
1162644951 19:12041974-12041996 CAAACTAAGCAGAAAAACTAAGG + Intronic
1163201547 19:15773222-15773244 CAAAGAGAAGTGAAGAACTGGGG - Intergenic
1165811950 19:38617257-38617279 AAAAGAAAAAAAAAGAACTGAGG + Intronic
1167865387 19:52321727-52321749 GACAGGAAACAGAGGAACTGTGG - Exonic
924964385 2:61770-61792 AGAAGTAGACAGTAGAACTGTGG + Intergenic
925467954 2:4126869-4126891 AAAAGTAAAAAGAAGAACAGAGG + Intergenic
925731959 2:6925463-6925485 GAAAGTAAAGAGAGCAACTGGGG - Intronic
925875851 2:8310602-8310624 ACAAGTAAACAGGAGAAGTGGGG + Intergenic
926919494 2:17926546-17926568 GCAAGTGGACAGAAGAACTGAGG - Intronic
927104112 2:19809502-19809524 CCCAGTTGACAGAAGAACTGAGG - Intergenic
927426906 2:22991156-22991178 CAAAGTAAACGGAAAGACTGAGG + Intergenic
928177907 2:29047430-29047452 CAGAGTTAACAGAAGACCTATGG - Intronic
928772832 2:34722271-34722293 TAAAGTTAACAGAAGACCTTTGG - Intergenic
928896724 2:36274098-36274120 CCAGGTAGACAGAAGAATTGGGG + Intergenic
929439745 2:41955661-41955683 CCAAGTAAGAGGAAGAACTGTGG - Intergenic
929478141 2:42274406-42274428 CAAAGGCAACAGCAGAACTTCGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930815991 2:55598265-55598287 TAAAGTAAACAAAAGAAATTGGG - Intronic
930841692 2:55854230-55854252 CAAAGTAAAAAACAGAACTCAGG - Intergenic
931707313 2:64957913-64957935 CACAGGAAACATAAGAAGTGGGG + Intergenic
933915255 2:86985256-86985278 CAAAATAAGCAGAAGAACAAGGG - Intronic
934007738 2:87784645-87784667 CAAAATAAGCAGAAGAACAAGGG + Intronic
934112204 2:88754467-88754489 CACAGTAATCAGATGAGCTGAGG + Intergenic
935064495 2:99636201-99636223 CAAAGTAAGATGAGGAACTGTGG + Intronic
935190520 2:100774621-100774643 CAAAGAAAACAGTTGTACTGAGG + Intergenic
935608093 2:104990837-104990859 CAAAGTGAACTGATGATCTGTGG - Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936643412 2:114342133-114342155 ATAAGTAAACAAATGAACTGAGG - Intergenic
936753882 2:115679802-115679824 AGAAGTAAAGAGAAGAACTGTGG + Intronic
937381017 2:121376482-121376504 AGAAGTAGACAGTAGAACTGTGG + Intronic
937543798 2:122990023-122990045 CAAAGAGAAGAGAAGAGCTGTGG + Intergenic
937720850 2:125094086-125094108 CAAAATAAAAAGTACAACTGTGG - Intergenic
937868110 2:126768979-126769001 AAAAGTAAACAGAAGAGGTAGGG + Intergenic
938966128 2:136390155-136390177 CAAAAAGAACAGAAGAAATGAGG - Intergenic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
939270014 2:139927340-139927362 CAAAGTAAACAAAACGAATGTGG - Intergenic
939370302 2:141290911-141290933 CAAATGAAACAGAACATCTGAGG + Intronic
939426172 2:142039567-142039589 CAAACTAAACAGAATTCCTGGGG + Intronic
939513163 2:143132388-143132410 CATAGTGAAAAGAAGAGCTGAGG - Intronic
939966476 2:148615274-148615296 CATATTACACAAAAGAACTGAGG - Intergenic
940611534 2:155998693-155998715 CAGAGTAAACAGATAACCTGTGG + Intergenic
941536411 2:166727511-166727533 CAAAGTCAACAAAAGCAGTGAGG + Intergenic
942032613 2:171977952-171977974 CAACATCAACAGAAAAACTGTGG + Intronic
942471016 2:176259853-176259875 CAAAGATAAAAGAAAAACTGAGG + Intergenic
942488409 2:176464373-176464395 CAAAGTCAAGAGACAAACTGAGG - Intergenic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942875570 2:180792469-180792491 GAAACTAAACAGAAAAAGTGGGG + Intergenic
943380786 2:187143864-187143886 AATATTAAAAAGAAGAACTGGGG + Intergenic
943473422 2:188324229-188324251 CTAAGTAAACACAAGAAGAGTGG - Intronic
943520020 2:188937469-188937491 CAAAAAAAACAGAAGAACTCAGG + Intergenic
944360907 2:198855227-198855249 CAAAGTCAACAAAAGCAATGGGG + Intergenic
944909408 2:204294858-204294880 CAAAACAAACAAAAGAACTCTGG + Intergenic
944963740 2:204905705-204905727 CAAAGTGAACAGAGGAAGAGTGG + Intronic
945140672 2:206683315-206683337 AAAAGTAAAAAGAAGAGGTGAGG - Intronic
945862333 2:215138352-215138374 CAGCAGAAACAGAAGAACTGTGG - Exonic
946319365 2:218941931-218941953 CAAAGTCAACAAAAGCAATGGGG - Intergenic
946603957 2:221381048-221381070 CAGAGTAAATAAATGAACTGAGG + Intergenic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
947314908 2:228846223-228846245 CATATTCCACAGAAGAACTGAGG + Intergenic
947552386 2:231055731-231055753 CAAAGTAAACAGATTACTTGGGG - Intergenic
1168755475 20:314140-314162 CAAAACAAACAAAAGAAGTGTGG - Intergenic
1168811750 20:709393-709415 CAAAATACACGGAAGAATTGGGG - Intergenic
1170267664 20:14485914-14485936 AAATGGAAACAGAAGAACAGGGG + Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171314250 20:24174005-24174027 CAAACATCACAGAAGAACTGAGG - Intergenic
1171748113 20:29019860-29019882 CAGAGTAAACAGAAAAACTATGG + Intergenic
1171781745 20:29425529-29425551 CACAGTAAACAGAAAACCTATGG + Intergenic
1172562507 20:35901913-35901935 CAAACTAATCACAAGAACTCAGG - Intronic
1172562509 20:35901967-35901989 CAAACTAATCACAAGAACTCAGG - Intronic
1173264213 20:41463658-41463680 TAAAATAAAAAGAAAAACTGAGG + Intronic
1173416949 20:42865369-42865391 TAAAGGAAACAGAAAATCTGAGG - Intronic
1173923154 20:46760921-46760943 AAATGTAAACAGATGAAATGAGG - Intergenic
1173956170 20:47034624-47034646 CAAAGTTAAAAGGAAAACTGAGG + Intronic
1174045917 20:47732860-47732882 CAAAGAAAACAAAAAACCTGAGG + Intronic
1175005452 20:55677485-55677507 TAAAGGAATCAGCAGAACTGTGG - Intergenic
1175136738 20:56829889-56829911 CAATGTCAACAGCAGACCTGAGG - Intergenic
1175196501 20:57247286-57247308 CAAAGAAGACAGAAGAAATTGGG - Intronic
1175467826 20:59204512-59204534 CAAAGCAAAGAGAAGAGCAGTGG - Intronic
1177014756 21:15772618-15772640 CAAAAGAAACAGAATAACTTTGG - Intronic
1177107638 21:16979696-16979718 AAAAGGAATCAGCAGAACTGTGG + Intergenic
1178166796 21:29987075-29987097 CATAGTAAAGAAAAGTACTGTGG + Intergenic
1178867133 21:36338172-36338194 TGAAGTAAACAGAAGAGCTATGG - Intronic
1178980640 21:37261222-37261244 CAAAGTGAACAGAATAACATGGG - Intronic
1180395090 22:12324243-12324265 CAGAGTAAACAGAAAACCTATGG - Intergenic
1180404650 22:12540506-12540528 CAGAGTAAACAGAAAACCTATGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181621691 22:24095599-24095621 CAAAGAGAACAGCAGCACTGTGG + Intronic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1184311229 22:43644393-43644415 CAAAGTAAACAGAATCCCAGAGG - Intronic
1184578152 22:45391517-45391539 CAAAGTGAAAAGAATCACTGTGG - Intronic
1185160140 22:49219870-49219892 GAAAAAGAACAGAAGAACTGAGG + Intergenic
1185272901 22:49936818-49936840 TGAAGTAAACAGGTGAACTGAGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949750903 3:7351641-7351663 CAAAGCAGGCAGAAGAAGTGGGG + Intronic
950233287 3:11295301-11295323 AAAAGCAAACAGAAGGAATGAGG - Intronic
950848529 3:16039159-16039181 CAAAGTCAACAAAAGCAATGAGG - Intergenic
952228207 3:31401023-31401045 CAGAGTAAACAAAAAATCTGCGG - Intergenic
953515276 3:43584838-43584860 CAAATTAAACGTAAGATCTGGGG + Intronic
953986396 3:47446473-47446495 AAAAGTAAACATAAGAATTGAGG - Intronic
954012581 3:47655042-47655064 CAAAGTAGAGAGAACAACAGGGG + Intronic
954840890 3:53510439-53510461 CAAAGAAAACAAATAAACTGTGG - Intronic
956244992 3:67172950-67172972 TAAACAAAACAGAATAACTGGGG + Intergenic
956506543 3:69946445-69946467 CCATGTTAACAGCAGAACTGGGG - Intronic
957511408 3:81192701-81192723 CAAAGAAAACAAAAGAATTATGG - Intergenic
957564069 3:81862724-81862746 CAACCTAAAGAAAAGAACTGAGG + Intergenic
957569989 3:81934707-81934729 CATAATTAACAGAAGAACTGAGG + Intergenic
957641226 3:82855939-82855961 CAAAGTAGACAAAATAACCGTGG - Intergenic
957941671 3:87013679-87013701 CAAAGTTAACTGATAAACTGTGG + Intergenic
958415075 3:93864377-93864399 CAATGTAAACTGAAGAGTTGAGG + Intergenic
958490233 3:94763334-94763356 CAAAGTAAAAAGAACAAATCTGG - Intergenic
958724425 3:97887362-97887384 CAAAGTAAACAAAAACAGTGAGG - Intronic
959059846 3:101606093-101606115 AAAAGTAACCAGAAGAAATCTGG - Intergenic
959570910 3:107882710-107882732 CATAGTTACCAGAACAACTGGGG - Intergenic
959835040 3:110908421-110908443 CACAGTAAGCCAAAGAACTGGGG + Intergenic
960125800 3:113997161-113997183 ATAAGTAAACAGATGAATTGTGG + Intronic
960158220 3:114319525-114319547 CACAGTAAAGGGAAGAACAGCGG - Intergenic
960613565 3:119577155-119577177 AAAAACAAACAGAAAAACTGGGG - Intergenic
960707712 3:120496329-120496351 CATAGGAAAGAGAAGCACTGAGG - Intergenic
961947938 3:130713587-130713609 CAAGGTAAAAAGAAGAGATGAGG + Intronic
962324223 3:134419842-134419864 CTAAGTAAACAGGAGTCCTGGGG - Intergenic
962374693 3:134850354-134850376 CACAGTACAGAGAAGAACTAAGG - Intronic
962467036 3:135670143-135670165 CACAGTTAACAGAAGCAGTGAGG - Intergenic
962719916 3:138163452-138163474 CCAAGTAATCAGGAGCACTGGGG + Exonic
962834356 3:139173747-139173769 CAAAGAAACCAGAAGTTCTGGGG - Intronic
963243071 3:143030099-143030121 CAAATTATCCAGAAGATCTGAGG + Intronic
964423659 3:156530653-156530675 CTAAGGAAGCAGAAGAAGTGAGG + Intronic
964428543 3:156579395-156579417 GCAAGTAAATTGAAGAACTGAGG - Intergenic
965049224 3:163622801-163622823 CAAACACAACAGAAAAACTGTGG - Intergenic
965575777 3:170217166-170217188 ATAAGTAAATAGAAGAAGTGTGG - Intergenic
966374101 3:179277962-179277984 CAAAGGAATCAGAAGAAAAGGGG - Intergenic
966415511 3:179685692-179685714 CAAAGTTAGCAGCAGAACTGTGG + Intronic
967617028 3:191582705-191582727 CAAAGTTAAGAGAAAATCTGTGG + Intergenic
970333975 4:15013491-15013513 AAAACTAAATAGAAGAACTAAGG - Intronic
970906941 4:21226757-21226779 GATAGTTAACAGAAGCACTGAGG + Intronic
971535375 4:27741517-27741539 CAAAGTAAATAAAAGCTCTGTGG - Intergenic
971732337 4:30401091-30401113 CATACAAAACAGAAGACCTGTGG + Intergenic
971761425 4:30771160-30771182 CAAATTAAAAACAAGAAATGTGG - Intronic
971800545 4:31284974-31284996 CAAAGTAAAAAGTACAAATGGGG + Intergenic
972158069 4:36189590-36189612 CAAAGTAAAAAGTAGTACAGAGG - Intronic
972863721 4:43204085-43204107 CAATGTAAACAAAAGAAAAGAGG + Intergenic
972943164 4:44221746-44221768 AAAAGCAGACAGAAGAACGGTGG - Intronic
973754188 4:54057096-54057118 CAAAACAAACATAAGAACTGAGG + Intronic
973997071 4:56468995-56469017 CAAAGTATAAGGAAGAACTCAGG - Intronic
974319560 4:60329468-60329490 CAAAGTAAAAAGAAGAAATTAGG + Intergenic
976526052 4:86090215-86090237 AAAAATAAACAGAAGAATTAGGG + Intronic
977080221 4:92517548-92517570 AAAAGGAAACAGAAGATATGAGG - Intronic
979207737 4:118060943-118060965 CAAAGGAAACAGTAGAAATCTGG - Intronic
980071852 4:128252122-128252144 AAAAAAAAAAAGAAGAACTGAGG + Intergenic
981188411 4:141833353-141833375 CAAAGCTAACAGAAGACCTTTGG - Intergenic
981512112 4:145568731-145568753 CCAAGTAAACAGAAAAAAAGTGG + Intergenic
981621212 4:146700953-146700975 CAAAGTGGACAGATCAACTGAGG + Intergenic
981845697 4:149165984-149166006 CAAAGCAAATGGAAGAAATGGGG + Intergenic
982050089 4:151492102-151492124 GAAAGTCAACAGAAAAACAGTGG + Intronic
982237431 4:153264731-153264753 CAATGTGCTCAGAAGAACTGAGG - Intronic
982491973 4:156040829-156040851 GAAAGTCAACAAAAAAACTGTGG + Intergenic
983190078 4:164745798-164745820 CAAAGTTGCCAGAAGAAATGTGG - Intergenic
984835617 4:184017381-184017403 TTAAGTAAACACAAAAACTGTGG - Exonic
985295076 4:188428291-188428313 AACAGAAAACAAAAGAACTGAGG - Intergenic
985986389 5:3520197-3520219 CAAAATACACAGCAGAATTGTGG + Intergenic
986277733 5:6294260-6294282 CAGAGTAAACAGATGACCTATGG - Intergenic
987127411 5:14827354-14827376 CAAGGTAAGCTGATGAACTGGGG + Intronic
987232036 5:15904535-15904557 CAAAGGATAAAGAACAACTGTGG + Intronic
987585848 5:19855199-19855221 CATAGGAAACAGAAGAGCAGGGG - Intronic
988085895 5:26475378-26475400 CCAAGAAAACAGAAGCACAGAGG - Intergenic
988321860 5:29708702-29708724 TAAAATAAACAGAACAACTGTGG + Intergenic
988547186 5:32169322-32169344 CAAAATAAAGCGAAGACCTGGGG + Intronic
989784404 5:45310214-45310236 CAGAGTAAACAGACAACCTGTGG + Intronic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990122629 5:52473952-52473974 CAAAGTAAATAGTAGAACAGAGG - Intergenic
990130724 5:52579838-52579860 AAAAGTAAACAGAAAGAGTGAGG - Intergenic
990652450 5:57917447-57917469 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
992127646 5:73658233-73658255 TAGAGTAAAGAGAAGAAATGGGG - Intronic
992510990 5:77434696-77434718 CAAAGAAAAAAAAAGAAATGAGG + Intronic
993035599 5:82753434-82753456 AAAAGCTAACTGAAGAACTGTGG - Intergenic
993064533 5:83081205-83081227 CAAAGTAAAAAGAGAAAATGGGG - Intronic
993189284 5:84660652-84660674 CAAAGCCAACAGAAGAATTGAGG - Intergenic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
993465627 5:88242898-88242920 CAATGTAAAAAGATAAACTGGGG + Intronic
993594598 5:89836802-89836824 AAAAGTAATCAGAATAACTCTGG - Intergenic
993845899 5:92942854-92942876 GAAACTAGAAAGAAGAACTGGGG - Intergenic
993877245 5:93322124-93322146 CAAAGGAAAAAAAAAAACTGTGG - Intergenic
994614258 5:102083611-102083633 CAGAGTAAACAGACAATCTGTGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996472974 5:123881443-123881465 TACAGTAAACACAATAACTGTGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
996885620 5:128350558-128350580 AAAAGTAAACAAAAGATTTGAGG + Intronic
997014414 5:129915275-129915297 CTAAGTAAACTGAAAAATTGAGG + Intronic
997797975 5:136829936-136829958 CTAAGTAAAAAGAATAAATGTGG - Intergenic
998487071 5:142512135-142512157 TAAAGTTACCAGGAGAACTGCGG + Intergenic
998901638 5:146861508-146861530 CAAAGTAAAAGGAAGAACTCAGG + Intronic
998928102 5:147149492-147149514 CAGCGTAAACAGAAGAGCTGTGG + Intergenic
999609983 5:153358725-153358747 CAAAGAAAAGAGAGGAATTGCGG - Intergenic
999845174 5:155471212-155471234 TAAAGTAAATAGAAGAACCTTGG + Intergenic
1000073588 5:157763960-157763982 CAATGTATACTGAAGAGCTGGGG - Intergenic
1000711405 5:164584327-164584349 AAAAGTAAAAATAAGTACTGAGG - Intergenic
1001046584 5:168377479-168377501 CAGAGTAAACAGAAAACCTATGG + Intronic
1001234115 5:170015007-170015029 TAAAGCAAACAGCTGAACTGGGG - Intronic
1002893601 6:1360118-1360140 CAAAAAAAAAAGAAAAACTGAGG + Intergenic
1003118358 6:3298490-3298512 AGAAGTAAAAAGAAGAACAGAGG + Intronic
1003479699 6:6519700-6519722 AAAAACAAACACAAGAACTGAGG + Intergenic
1003992001 6:11495395-11495417 CTAATTAACCACAAGAACTGAGG - Intergenic
1004423552 6:15492491-15492513 AAAAGGAAACAGAAGAATGGAGG - Intronic
1004429837 6:15533396-15533418 CTGAGGAAACAGAATAACTGGGG + Intronic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1005392908 6:25351474-25351496 CAAAGTACAAAGAACAAATGTGG + Intronic
1006962148 6:37943823-37943845 CAAAGTAAACTGAAGTGGTGAGG + Intronic
1008566129 6:52770354-52770376 CAAAGTAGACAGATCACCTGAGG - Intergenic
1008802342 6:55384462-55384484 AAATGTAAACAGTAGAATTGTGG - Intronic
1008887323 6:56445301-56445323 CAAAGTCAAAAGACAAACTGGGG - Intergenic
1008986391 6:57548762-57548784 AAAAGTAGAAAGAAGAGCTGTGG + Intronic
1009174354 6:60441339-60441361 AAAAGTAGAAAGAAGAGCTGTGG + Intergenic
1009333313 6:62453627-62453649 CCAATAAAACAGAAAAACTGTGG - Intergenic
1009446076 6:63743851-63743873 CAAAATAAACAGTTGAACTCTGG + Intronic
1009876086 6:69507097-69507119 CAAAGCAGGCAGAAGAACTGGGG - Intergenic
1011679835 6:89772286-89772308 AAAAATAAAAAGAAGAAATGAGG + Intronic
1012041126 6:94205425-94205447 CAAAGGAAAGAGTAGAATTGGGG + Intergenic
1012192338 6:96295936-96295958 CAAAGCAAACAAAAAAAGTGGGG + Intergenic
1012901835 6:105015088-105015110 TACAGTTAACAGAACAACTGGGG - Intronic
1013857144 6:114586913-114586935 CAAAATAAACAGAAAAACAATGG + Intergenic
1014153864 6:118089371-118089393 TAAAAGAAACAAAAGAACTGGGG + Intronic
1014650388 6:124029458-124029480 AAAAGTATAGAGAAGAACTGGGG - Intronic
1015044488 6:128761380-128761402 AAAAGTAAAAAGCAGAACAGAGG + Intergenic
1015653171 6:135485986-135486008 CAGTATAAACTGAAGAACTGAGG - Intronic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1017150389 6:151274068-151274090 CAAAAAAAAAAAAAGAACTGAGG - Intronic
1017727127 6:157283606-157283628 CAAAGAAATCAGAAGCTCTGGGG + Intergenic
1017930995 6:158955244-158955266 AAAAGTAACCAGAAAAGCTGTGG - Intergenic
1018304334 6:162439164-162439186 CAAATGCAACAGAAAAACTGCGG - Intronic
1020412789 7:7911812-7911834 CAAAGAAAATAGAAGATATGAGG - Intronic
1021367360 7:19796399-19796421 GAAAGTAGACAGTAGAATTGTGG - Intergenic
1021543262 7:21784097-21784119 AAAAGAAAACTGAAGAACAGAGG + Intronic
1021826323 7:24555945-24555967 CAAAATAGACAGATGTACTGTGG + Intergenic
1022365051 7:29705237-29705259 CAAAGTAAGCAGAAGAAATGAGG - Intergenic
1022932657 7:35136352-35136374 CAAAGTAAGCAAAAGAAATGAGG + Intergenic
1024139823 7:46450820-46450842 CATGGTCAACAGAAGAATTGAGG + Intergenic
1024220053 7:47280195-47280217 CAAATTAAAGAGAAAAACAGAGG + Intronic
1024409439 7:49023187-49023209 CTAAGGAAACAGAAGAGCAGAGG - Intergenic
1024999682 7:55305053-55305075 CAAAGTAAACAGATAACCTATGG + Intergenic
1025308166 7:57886990-57887012 AAAACTAAACAGAAGAATTCTGG - Intergenic
1025520431 7:61722757-61722779 AAAAGTAGACAGAAGAATTATGG - Intergenic
1025544751 7:62151412-62151434 AAAAGTAGACAGAAGAATTATGG - Intergenic
1026906256 7:74064620-74064642 CAAAATAAAAACAAGAAATGTGG + Intronic
1028290389 7:89057955-89057977 GCAAGTAAAGAGAACAACTGAGG + Intronic
1028407079 7:90486745-90486767 CAAAGTAGTAATAAGAACTGAGG - Intronic
1028772728 7:94645062-94645084 CTTAGTAAACATAAGACCTGGGG - Intronic
1029025728 7:97415484-97415506 CACAGTGAAAAGAAGAAATGAGG + Intergenic
1029828579 7:103229138-103229160 CAAAGTAAGCAAAAGAAATGAGG + Intergenic
1030453124 7:109737991-109738013 CAAAGCAAACAAAAAAAGTGCGG - Intergenic
1031936092 7:127737214-127737236 CACAGTAGACAGAACAGCTGGGG - Intronic
1033481772 7:141749357-141749379 AAAAATAAACAAAAGAACAGAGG - Intronic
1034111927 7:148545544-148545566 AAAATTAAACAGAAAAACCGAGG + Intergenic
1034278138 7:149833130-149833152 CAAAGGAAACAGATGAGCTGGGG - Intergenic
1034431287 7:151042461-151042483 CAGACTGAACAGAAGAAATGGGG + Intronic
1035092009 7:156320635-156320657 AACAGTAAACTGAATAACTGAGG - Intergenic
1035877440 8:3206740-3206762 CAAAGTAAATAAGATAACTGGGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1037369161 8:18155270-18155292 GAAAGTACAGAGTAGAACTGTGG + Intergenic
1038016220 8:23517565-23517587 CAAAGTGAGCAGATCAACTGAGG - Intergenic
1038019090 8:23537889-23537911 CAAGGCAAACAGAAGTGCTGAGG - Intronic
1038148236 8:24917924-24917946 CAAAGTCAAAAGCAGAAGTGGGG + Exonic
1038565242 8:28614561-28614583 CAAAGTAAACAGAAGAACTGGGG - Intronic
1038658795 8:29478667-29478689 CCAATCAAACAGAAGAACTGGGG - Intergenic
1038703277 8:29871199-29871221 CAAATGAAACAGAAGAACCAGGG - Intergenic
1039546799 8:38416281-38416303 CAAAATAAACAGACAAACTGGGG - Intronic
1039674527 8:39647067-39647089 CAAAGTATAGAGAAAAACAGTGG + Intronic
1039742893 8:40398304-40398326 TAACGTAAACAGAAGCACAGAGG + Intergenic
1040716907 8:50266818-50266840 CAAAGTGAAGAGTAGCACTGTGG - Intronic
1040995047 8:53392656-53392678 GTAAGAAAACAGAAGCACTGAGG - Intergenic
1041173407 8:55168597-55168619 TAAAGCAAACAGATGAAATGAGG - Intronic
1041535778 8:58923948-58923970 CAACACAAAGAGAAGAACTGGGG + Intronic
1041847447 8:62346964-62346986 CATTTTAAACAGGAGAACTGAGG + Intronic
1042237303 8:66625730-66625752 GAAAGAAATCAGAATAACTGAGG + Intergenic
1042682498 8:71401408-71401430 CAAAGTAAACAGCAGATATTGGG - Intergenic
1042889468 8:73591305-73591327 AAAAGTAAACAGAGTAAGTGCGG + Intronic
1042994841 8:74685422-74685444 CAAAGGAAACAGTAGAATTTTGG + Intronic
1043218547 8:77628009-77628031 GAAAGGAAAGAGAAGAGCTGAGG - Intergenic
1043600126 8:81927710-81927732 CAGAATAAATAAAAGAACTGAGG + Intergenic
1044395310 8:91703869-91703891 AAAAGTAAAAAGAACACCTGAGG - Intergenic
1045225136 8:100236599-100236621 GAAAACAAACAGAAGATCTGAGG - Intronic
1046467544 8:114626018-114626040 CAAAGTAAACAAAAGCAAAGTGG + Intergenic
1047027506 8:120840034-120840056 AGAAGGAAACAGAAGAGCTGTGG - Intergenic
1048091718 8:131248614-131248636 AAAAGTATACTGAAGAAATGTGG + Intergenic
1048258775 8:132926934-132926956 CAAAGGAAACAGAAGATCAAAGG - Intronic
1048744974 8:137604353-137604375 CATAGTAAGCAGAAAGACTGAGG + Intergenic
1050157111 9:2679352-2679374 GCAAGTAAACACAAGAACAGAGG - Intergenic
1050349500 9:4726769-4726791 CAAAGTAAATAGAAAAACTTAGG - Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050761627 9:9079234-9079256 GTAAGTAAACAGTAGAACAGAGG - Intronic
1050869350 9:10547133-10547155 CAATATCAACAGAAGAATTGGGG + Intronic
1050881345 9:10703958-10703980 CAAAGTAAACAGACAAGCTATGG - Intergenic
1051242271 9:15071478-15071500 CACAGGAAATAGAAGAACTTAGG + Intergenic
1051613174 9:18981401-18981423 CAAAGCAAACACTAGAACTCAGG + Intronic
1051828510 9:21249231-21249253 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1052398078 9:27965635-27965657 CAAAATAAACACGAGAACAGAGG - Intronic
1052485219 9:29088718-29088740 CATTTTAAACTGAAGAACTGTGG - Intergenic
1052533194 9:29714550-29714572 TAATATAAACAGAAGATCTGAGG + Intergenic
1053094199 9:35310220-35310242 CAAAGTCAAGTGCAGAACTGAGG + Intronic
1053251208 9:36575170-36575192 CTAAATAAATAGAAGAATTGGGG - Intronic
1054860072 9:69942384-69942406 CAAATTTAACAAAAGAAGTGTGG + Intergenic
1054984472 9:71245655-71245677 ATAACTAAATAGAAGAACTGTGG + Intronic
1055250567 9:74298765-74298787 CAAAGTAAACAGAACAAAATGGG + Intergenic
1055591041 9:77814105-77814127 CAAAAGAAACAGAAGGACAGAGG + Intronic
1056645847 9:88411210-88411232 CAAGGTGAACAGAAGACTTGTGG - Intronic
1056842227 9:90007605-90007627 CACAGTAGAGAGAACAACTGTGG - Intergenic
1057896161 9:98910413-98910435 GAAAATAACCAGAAAAACTGAGG + Intergenic
1057923593 9:99121516-99121538 CAGATTACTCAGAAGAACTGGGG + Intronic
1060605167 9:124907524-124907546 CAAAGTTAACAGAATGACTCAGG + Intronic
1203410307 Un_KI270581v1:2419-2441 CAGAGTAAACAGAAAACCTATGG + Intergenic
1185561677 X:1064707-1064729 AAAACAAAACAAAAGAACTGAGG - Intergenic
1185647933 X:1628394-1628416 CAAAGCAAAGTGAAGAGCTGAGG - Intronic
1186194448 X:7097247-7097269 GAAAGCAAACAGATGAGCTGGGG + Intronic
1186794003 X:13026468-13026490 CTAATTACACAGAAGAACTCTGG - Intergenic
1186885435 X:13908565-13908587 CACAGCAAAGAGAAAAACTGGGG + Intronic
1188697637 X:33215464-33215486 CAAAGTAAACAGACGAAGAATGG - Intronic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1189451471 X:41135929-41135951 CATAGTATACAAAAGAACAGAGG - Intronic
1189708773 X:43787085-43787107 CAAATGAAACAGAAAAACTATGG + Intronic
1191036935 X:56035147-56035169 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
1193020568 X:76787963-76787985 CAGAGTAAACAGAAAACCAGCGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193622859 X:83778023-83778045 CAAAGTAAAAAGAACAACGTTGG - Intergenic
1194865361 X:99058167-99058189 CAAAGAAAACTGAAGAGCAGAGG - Intergenic
1194956964 X:100192177-100192199 TAAGGTAAAGAGAAAAACTGAGG + Intergenic
1195038304 X:100990359-100990381 GAAAGTAAAGAGAAAAACAGAGG + Intronic
1195242933 X:102971212-102971234 CAAAGTTAGCAGAAGAAATAAGG + Intergenic
1195498147 X:105561913-105561935 CAAAGTCAACAGAGGATCTCAGG + Intronic
1197007955 X:121525908-121525930 CAGAGTAAACAGACAATCTGTGG + Intergenic
1197957837 X:131972081-131972103 GCAAGTAGAAAGAAGAACTGGGG + Intergenic
1198728781 X:139705006-139705028 CACAGTAAACAAAACAACTTGGG + Intronic
1199927958 X:152489237-152489259 CAAAGAAGACAGTAGAACAGTGG - Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic