ID: 1038566461

View in Genome Browser
Species Human (GRCh38)
Location 8:28623223-28623245
Sequence CAGCGCGCGAGGCGGGCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566461_1038566467 -1 Left 1038566461 8:28623223-28623245 CCACGCGCCCGCCTCGCGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1038566467 8:28623245-28623267 GTCAGGAGGCGCTGTCCCCGTGG No data
1038566461_1038566472 16 Left 1038566461 8:28623223-28623245 CCACGCGCCCGCCTCGCGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566461_1038566473 17 Left 1038566461 8:28623223-28623245 CCACGCGCCCGCCTCGCGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1038566473 8:28623263-28623285 CGTGGGTAAGCCCGTGCCGTGGG No data
1038566461_1038566468 0 Left 1038566461 8:28623223-28623245 CCACGCGCCCGCCTCGCGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1038566468 8:28623246-28623268 TCAGGAGGCGCTGTCCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566461 Original CRISPR CAGCGCGCGAGGCGGGCGCG TGG (reversed) Intronic
900152209 1:1183616-1183638 GAGCGCGCCAGGCGGGCGCTAGG - Intronic
900182102 1:1315694-1315716 AAGCGCGGGAGGCGGGGGTGGGG + Intronic
900314563 1:2050460-2050482 CGGCGCGCGGGGCGGGAGCGGGG - Exonic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
901242870 1:7704960-7704982 GCGCGCGCGGGGCGGGGGCGGGG + Intronic
901433881 1:9234722-9234744 GGGCGCGCGCGGCGGGGGCGGGG - Intergenic
901793012 1:11664337-11664359 CAGCGCGTGACGCGGCGGCGGGG + Intronic
902444388 1:16452761-16452783 CGGCGGGCGGGGGGGGCGCGCGG - Intronic
902870730 1:19312245-19312267 CAGCGCGCGGCGTGGGGGCGGGG + Intergenic
903597032 1:24502843-24502865 GAGGGGACGAGGCGGGCGCGCGG + Intronic
903875989 1:26473085-26473107 CAGCGCGCGTCTCGTGCGCGGGG - Intronic
904517288 1:31066027-31066049 CCGAGGGCGCGGCGGGCGCGAGG - Intergenic
904768996 1:32870694-32870716 CGGAGCGCGGCGCGGGCGCGGGG + Exonic
905975798 1:42172776-42172798 CAGCGAGCGAGGCTGGCAAGAGG - Intergenic
905996042 1:42381096-42381118 CGGTGAGCGAGGCGGGCCCGGGG + Exonic
907442588 1:54488348-54488370 CAGCGCCCGAGCGGAGCGCGCGG + Intergenic
907513787 1:54980765-54980787 CAGCCCTCGGGGCGGGCGCCGGG + Intergenic
907689145 1:56645252-56645274 AGGGGCGCGGGGCGGGCGCGGGG - Intronic
907767366 1:57424158-57424180 CGGGGCGCCGGGCGGGCGCGGGG - Intronic
910450131 1:87335471-87335493 CAGGGCGGGAGCCGGGCGAGCGG + Intronic
914824571 1:151132143-151132165 CAGCGCGCGCGGCCCGCCCGGGG + Exonic
917434178 1:175001983-175002005 CAGAGGCCGAGGCGGGCGGGCGG - Intronic
918048213 1:180953961-180953983 CTGAGGGCGGGGCGGGCGCGGGG - Intergenic
920655220 1:207869224-207869246 CAGCGCCCGACGCGGCCGCTGGG - Intergenic
921039467 1:211416435-211416457 CCGCGGGCGAGGCAGGAGCGCGG + Intergenic
922025275 1:221743191-221743213 CAGCGCGCCAGGCGGGAAAGGGG - Intergenic
922757275 1:228103322-228103344 CGGCGCGCGACGCGGAGGCGGGG - Exonic
922937307 1:229432487-229432509 CAGCGCTAGCGGCGGGGGCGGGG + Intronic
923163749 1:231339581-231339603 CATCGCGGGAGGCGCCCGCGGGG + Intronic
923372738 1:233328698-233328720 CGGCGCGCGCGGCGGGGGCCGGG - Exonic
923490261 1:234478341-234478363 CCGCGCCCGCGGCGCGCGCGAGG - Exonic
1063200994 10:3785312-3785334 CCGCGCACGGGGCGGGCGCGGGG - Intergenic
1064167847 10:13001764-13001786 CAGGGCGGGAGGCGGGCGCCCGG - Intronic
1064622273 10:17228729-17228751 CGGCGCGCGAGGCTGCGGCGAGG + Intronic
1066406997 10:35127426-35127448 GAGCGCACGAAGCGGGCGTGGGG - Intronic
1067694176 10:48523638-48523660 CAGGGCGCGCGCCGGGCTCGCGG + Intronic
1072591431 10:96832104-96832126 CGGCGCGCGGGGCGGGTGAGCGG + Intergenic
1073137702 10:101228936-101228958 CAGGGCGCGGGCCGGGCGCGGGG + Exonic
1073207390 10:101776208-101776230 CCGGGCGCGAGGGGGGAGCGCGG + Intronic
1074086178 10:110210156-110210178 CCCCGCGCGGGGCGGGCCCGTGG + Intronic
1076880311 10:133236565-133236587 GAGCCCGGGAGGCGGGCGCTGGG - Intergenic
1077020911 11:416822-416844 GCGCGCGGGAGGCGGGCACGGGG + Intronic
1077043700 11:535367-535389 CTGGGGGCGAGGAGGGCGCGCGG + Intronic
1078594482 11:12674666-12674688 CAGCGCGCCAGCCGGCCCCGGGG + Exonic
1083659844 11:64246894-64246916 CAGCTCGGGCGGCGGCCGCGGGG - Exonic
1083883129 11:65558076-65558098 CAGCGGGGGAAGCGGGCGGGAGG + Exonic
1083965870 11:66043425-66043447 CAGCACGTGCGGCGGCCGCGTGG + Exonic
1084310448 11:68313222-68313244 GAGCACGCGGGGCGGCCGCGCGG - Intronic
1085205789 11:74731259-74731281 CAGCGGGTGTTGCGGGCGCGCGG + Intronic
1088462107 11:110093089-110093111 TAGGGCGCGGGGCGAGCGCGAGG - Intergenic
1089556242 11:119317217-119317239 CGGCGCGCGGGGCGGGGGCTGGG - Intronic
1089729533 11:120511717-120511739 CTGCGAGCGAGCCCGGCGCGGGG - Intergenic
1090229136 11:125089272-125089294 CAGCGAGCGAGGCTGGCATGGGG + Intronic
1090363217 11:126187342-126187364 CAGGGAGCGAGGCAGGTGCGAGG + Intergenic
1091226016 11:133956824-133956846 GCGGGCGCGAGGCGGGCGCTCGG - Exonic
1091226019 11:133956835-133956857 GGCGGCGCGAGGCGGGCGCGAGG - Exonic
1091594349 12:1865701-1865723 CAGCCCGGGCGGCAGGCGCGAGG + Intronic
1091616185 12:2052886-2052908 CGGCGCGCCGGGCGGGCGGGCGG + Intronic
1091625071 12:2115464-2115486 CAGGGCTCGGGGCGGGCGTGTGG - Exonic
1092256195 12:6927955-6927977 CCGCGGGCGAGGCGGCCGAGGGG + Intronic
1092861828 12:12725252-12725274 CGGAGCGCGGGGCAGGCGCGCGG - Intergenic
1095752966 12:45730319-45730341 GCGTGCGCGCGGCGGGCGCGGGG + Intronic
1096241334 12:49961807-49961829 CCGGGCGCGGGGCCGGCGCGGGG - Intergenic
1096435947 12:51591214-51591236 CGGTGCGGGGGGCGGGCGCGGGG + Exonic
1096498302 12:52051151-52051173 TAGCGGGCGCGGCGGGCGCGAGG + Intronic
1100565602 12:95790852-95790874 AAGCGCGGGGGGCGGGCGGGAGG - Intronic
1101479623 12:105084469-105084491 CAGCGCGGGAGGCAGGCGGGCGG + Exonic
1101910569 12:108857659-108857681 CGGCGCGGGAGGCGGGAGCTGGG - Intergenic
1102101279 12:110281023-110281045 CCGCGCGCGCCGCGGTCGCGGGG - Intronic
1102197042 12:111033623-111033645 CGCTGCGGGAGGCGGGCGCGCGG - Intergenic
1102240258 12:111320579-111320601 CGACGGCCGAGGCGGGCGCGCGG + Exonic
1102933865 12:116881317-116881339 CCGAGCGCGGGGCGGGAGCGAGG - Exonic
1102973538 12:117190117-117190139 CCGCGCGCGGGGCGGCCGCGGGG + Intronic
1103400695 12:120641059-120641081 CGCCGCGAGAGGAGGGCGCGCGG + Exonic
1103488188 12:121296733-121296755 CCGCCCGGGCGGCGGGCGCGCGG + Intronic
1103509731 12:121466609-121466631 CACGGCGGGCGGCGGGCGCGCGG + Intronic
1103563260 12:121803630-121803652 CCGGGCCGGAGGCGGGCGCGCGG - Intergenic
1103856297 12:123973053-123973075 GAGCGCGCGCGCCGGGCGCTGGG + Intronic
1104709853 12:130977804-130977826 CAGCGGCCCAGGAGGGCGCGAGG - Intronic
1104977766 12:132559943-132559965 GCGCGCGGGAGGCGGGAGCGCGG - Intronic
1106517113 13:30465254-30465276 CGGCGGGCGAGGGCGGCGCGGGG - Intronic
1111951350 13:94711702-94711724 CTGCGCTCAAGGCGGGCGCCGGG - Exonic
1112504449 13:99968024-99968046 GAGAGCGCGAGTCGGGCCCGCGG + Intronic
1113082332 13:106533255-106533277 GGGCGGGCGAGGCGGTCGCGGGG - Intronic
1113085661 13:106567510-106567532 CAGGGCGCGGGGCGAGGGCGTGG - Intronic
1113546311 13:111153789-111153811 CAGCGGGCGACGCTGGCGAGCGG - Intronic
1113846422 13:113394169-113394191 CGTCCGGCGAGGCGGGCGCGGGG + Intergenic
1114477478 14:23007090-23007112 CAGAGGCGGAGGCGGGCGCGCGG + Intronic
1115566583 14:34630042-34630064 GCGGGCGCGGGGCGGGCGCGGGG - Intronic
1115576251 14:34714696-34714718 CAGCGGGCGGGGCGGTCACGTGG + Intronic
1115610707 14:35046381-35046403 CGCGGCGCGAGGCGGGCGCTGGG + Exonic
1117392100 14:55271739-55271761 CAGCGCCCGGGCCGTGCGCGCGG - Intronic
1118288989 14:64503753-64503775 CCGCGCGAGAGGCGGCCGAGGGG - Exonic
1119759625 14:77141428-77141450 CCGCGGGCGAGGCGGGCGCCAGG - Intronic
1120905710 14:89619243-89619265 CGGGCCGCGAGGCGGGCGCGCGG - Intergenic
1122418334 14:101560834-101560856 GCGCGCGGGAGGCGGGCGGGCGG + Intergenic
1122635388 14:103127308-103127330 CAGCCAGCGCCGCGGGCGCGTGG - Exonic
1122904551 14:104795769-104795791 CCGGGCGCGGGGCGGGCGCGGGG - Intergenic
1122940336 14:104978298-104978320 CGGCGCACGGGGCGGGCGGGCGG + Exonic
1122975075 14:105167690-105167712 AAGCGCGCGGGGCCGGGGCGCGG + Intronic
1123004505 14:105314839-105314861 CGGCGGGCGGGCCGGGCGCGCGG - Exonic
1124142282 15:27088238-27088260 GAGTGCTCGGGGCGGGCGCGGGG + Intronic
1124237585 15:28003625-28003647 CAGCGCGTGAGCCGTGCGCAGGG + Intronic
1124427128 15:29571186-29571208 CAGGGCGCGAGGCGTGAGCGCGG - Intergenic
1124628995 15:31326702-31326724 CTGCGCGCGCGGAGGGGGCGGGG - Intergenic
1125694262 15:41622012-41622034 CAGCGCGTGCTGCTGGCGCGGGG + Intronic
1126109430 15:45166995-45167017 CAGCGCGCCAGGCCGGGGAGCGG - Intergenic
1126668454 15:51094807-51094829 CTGCGCGCGAGGCGAGCGCAGGG + Intronic
1126823749 15:52529265-52529287 CAGGGCGCGAGGCGGCGGCGGGG - Intergenic
1128877703 15:71215458-71215480 CAGCGTGCGAGGCAGGGGCAGGG - Intronic
1130906871 15:88246929-88246951 CAGGGCGGGAGCCGGGCGTGTGG - Intronic
1132055302 15:98647658-98647680 CAGAGGGCGCGGCGGGCGCTGGG - Intergenic
1132314354 15:100879600-100879622 GAGCGCGCGGCGCGGGCGCCGGG + Exonic
1132398234 15:101489578-101489600 CCGCGGGCGCGGGGGGCGCGGGG - Exonic
1132478663 16:154653-154675 CAGCTCCCGGGGCGGGAGCGGGG + Intronic
1132877948 16:2148621-2148643 CGGGGCGCGAGCCGGGCGCCCGG + Exonic
1132889453 16:2196651-2196673 GGGGGCGCGCGGCGGGCGCGGGG + Intergenic
1133464876 16:6019570-6019592 CAGCCCCGGAGGCGCGCGCGTGG - Intronic
1134149829 16:11797050-11797072 CGGCGCGCGCGGGGGGGGCGGGG + Intronic
1136190017 16:28609951-28609973 CTGCGGGCGAGGAGGGCACGAGG - Exonic
1136365122 16:29806260-29806282 CTGCGCGCGCACCGGGCGCGCGG - Intronic
1136428194 16:30183210-30183232 CAGGGGGCGCGGGGGGCGCGGGG - Intronic
1137267978 16:46884361-46884383 CGGCGCGGGCGCCGGGCGCGGGG + Exonic
1137683307 16:50369084-50369106 CAGCTCGCGGGCCGGGGGCGGGG + Intergenic
1137926598 16:52546979-52547001 CTGCGCGCGGGCCGGGCGCCGGG + Exonic
1139174326 16:64669359-64669381 CACCGTGCGGGGCGGGGGCGGGG + Intergenic
1141517483 16:84555536-84555558 CAGGGTGGGAGGCGGGCTCGGGG + Intergenic
1141946997 16:87317395-87317417 CAGCGGGACGGGCGGGCGCGCGG - Intronic
1142156218 16:88533883-88533905 GAGCGCGCGAGGAGGGGGCTGGG + Exonic
1142194786 16:88734365-88734387 CAGCGCGGGAGGCGCGTGCCAGG + Exonic
1142206282 16:88784718-88784740 GAGCGCGCCAGGCGGCGGCGGGG - Intronic
1142211879 16:88812293-88812315 GCGCGCGGGAGGCTGGCGCGCGG + Intergenic
1142295322 16:89217808-89217830 CAAGGCGCGAGGCAGGCGGGCGG - Exonic
1142859972 17:2755595-2755617 GAGGGCGCGGGGAGGGCGCGGGG - Intergenic
1142859977 17:2755606-2755628 GAGGGCGCGGGGAGGGCGCGGGG - Intergenic
1143116497 17:4584476-4584498 CTGCCGGGGAGGCGGGCGCGGGG - Intronic
1143661475 17:8327097-8327119 CCGCGGGAGGGGCGGGCGCGGGG - Intergenic
1143830266 17:9645576-9645598 CCGGGCGCGAGGCGGACGAGCGG - Exonic
1146255994 17:31391803-31391825 CGGCGGGCGCGGCGGGCGAGGGG + Exonic
1146281827 17:31549824-31549846 CATCGCTCGCGGCGGGCGCGGGG + Intergenic
1147150311 17:38510362-38510384 CTGAGGGCGCGGCGGGCGCGGGG + Exonic
1147672401 17:42184209-42184231 CGGCGCCCGAGGCAGGGGCGCGG + Exonic
1147890597 17:43713974-43713996 CGGCGCGGGGGGCGGGCGCGGGG + Intergenic
1148095720 17:45051620-45051642 CAGCGGGCGAGGCGGGACCTCGG + Exonic
1148337533 17:46851637-46851659 CAGCGCGGGCGGGGGGCGCATGG - Exonic
1148445203 17:47733386-47733408 CCGCGCGCGAGAGGGTCGCGTGG - Exonic
1149626355 17:58083352-58083374 CGGCGCGCGCGGCGGGGGGGCGG + Intergenic
1150239934 17:63622906-63622928 CGGCGCGCGAGCGGGGCGGGCGG - Intronic
1151478605 17:74357124-74357146 GGGCGCCCCAGGCGGGCGCGAGG + Exonic
1151954389 17:77373267-77373289 CCGCCCGGGAGGCGGGGGCGGGG + Intronic
1152357329 17:79813504-79813526 CGGCGGGGGCGGCGGGCGCGGGG + Intergenic
1152809611 17:82375363-82375385 CAGCGCTGGAAGCGGGCGCGGGG - Exonic
1153457382 18:5295756-5295778 CCGTCCGCAAGGCGGGCGCGGGG - Intronic
1153636523 18:7117759-7117781 GAGCGTTCCAGGCGGGCGCGCGG - Exonic
1155258084 18:24015265-24015287 GGGCGCGCGGGGCGGGCGCGCGG - Intronic
1155654555 18:28177943-28177965 CAGCGCGTGGGGCGAGCGCGGGG - Intergenic
1155928814 18:31685107-31685129 CAGCTCCCGCGGCGGCCGCGGGG - Intronic
1159947833 18:74457236-74457258 TGGCGCGGGCGGCGGGCGCGCGG - Exonic
1160015838 18:75139751-75139773 CAGCGTGGGAGGAGGGCCCGGGG - Intergenic
1160935589 19:1592933-1592955 CAGCGCGCTGGGAGGGGGCGGGG + Intergenic
1160948238 19:1653164-1653186 CAGCACGCGGGGCCGGCCCGAGG - Intergenic
1161108715 19:2456658-2456680 CCACGCGCGAGGTGGGCGCCGGG - Exonic
1161203623 19:3029142-3029164 CAGCGGCCGGGGCGGGAGCGCGG + Exonic
1161702665 19:5804062-5804084 CACCCCGCGGGGCGGGGGCGGGG + Intergenic
1162733848 19:12734771-12734793 CAGCGCCCGCAGCGGGGGCGGGG + Exonic
1163106329 19:15125029-15125051 CAGCGGGGGCGGCGGCCGCGGGG + Exonic
1163427141 19:17245889-17245911 CGCAGCGCGAGGCCGGCGCGCGG - Exonic
1163598240 19:18232900-18232922 CAGCGCGGGGGAGGGGCGCGCGG - Intronic
1163678614 19:18668121-18668143 CAGAGCACGTGGCTGGCGCGCGG - Exonic
1163681285 19:18683934-18683956 GGGCGCGCGCGGCGGGGGCGGGG + Intronic
1165867847 19:38949908-38949930 GCGCGAGCGAGGCGGGGGCGGGG - Intronic
1166219163 19:41353977-41353999 AAGCGCACGGGGCGGGAGCGGGG + Intronic
1166785292 19:45363707-45363729 CAGCGCGCGGGGTGGGGGCCCGG - Intronic
1167072741 19:47230431-47230453 CCGCCCGCCAGGCGAGCGCGGGG + Intronic
1167377265 19:49118894-49118916 CAGTTCCCGAGGCGGGCGCAGGG + Exonic
1167410334 19:49340352-49340374 CAGCGCACGTGACGGGGGCGGGG - Exonic
1167587644 19:50384014-50384036 CCGGGCGAGAGGCGGGCGGGGGG + Intergenic
1167940562 19:52942706-52942728 CAGAGGGCGGGGCGGGGGCGGGG + Intronic
926285315 2:11482987-11483009 CAGCGGGCGGAGCGGGGGCGCGG + Intergenic
927215850 2:20667441-20667463 CGGCGCGCGGCGCGGGCCCGGGG - Exonic
927917944 2:26948523-26948545 CAGCCCCCGAGGCTTGCGCGAGG + Exonic
928606417 2:32947841-32947863 GTGCGCGCGAGGCGGGCGGGCGG - Intronic
931291964 2:60881449-60881471 TCGCGCGCGCGGCGGCCGCGAGG + Intergenic
932036642 2:68252576-68252598 CAGCGCGCGGGGCGGGGGCGGGG + Intronic
932073476 2:68643478-68643500 CAGCTCGCGACGAGGACGCGCGG - Intergenic
933206436 2:79512971-79512993 CAGGACGCGGGGCGGGCGGGGGG + Intronic
933772676 2:85754159-85754181 CGGCGCGCGAGGCAGGGGCGTGG - Exonic
935275796 2:101474386-101474408 GAGCGCGCGGGGGGCGCGCGGGG + Intronic
936985722 2:118310174-118310196 CATCGCGGGCGGCGGCCGCGCGG - Intergenic
941096001 2:161239432-161239454 CAGCGCGCGAGGCGTGGCGGGGG - Intergenic
941905692 2:170715340-170715362 CCGCGCGCGGGGCGAGCGAGCGG + Exonic
942043361 2:172085209-172085231 AAGCGCGCGAGGGAGGCGGGAGG + Exonic
944579036 2:201116489-201116511 CAGCGCGGGGGTCGAGCGCGGGG - Intronic
946309220 2:218873472-218873494 CATTTCGCGAGGTGGGCGCGCGG + Exonic
947741387 2:232486563-232486585 CGGCGCGGGGGGCGCGCGCGGGG - Exonic
947800937 2:232928215-232928237 GGGCGCGCGCGGCGGGGGCGAGG + Intronic
948823235 2:240560771-240560793 GAGCGCGCGAGCCGCGGGCGCGG + Exonic
949014552 2:241702121-241702143 CCGCGTGGGCGGCGGGCGCGGGG - Intronic
949014620 2:241702276-241702298 GGGCGCGGGGGGCGGGCGCGGGG + Intronic
1170226443 20:13995899-13995921 GAGGGCGCGAGGCGGGAGCTCGG - Intronic
1172389890 20:34559288-34559310 GAACGCGCGAGGCGGGGGCGGGG - Intronic
1172661722 20:36573428-36573450 CAGCGCGCCCGGAGGGGGCGGGG - Intergenic
1173548185 20:43914914-43914936 CGGCGCCCGCGGTGGGCGCGCGG + Exonic
1173691753 20:44966437-44966459 CGGCGCGCGGCGCGGGAGCGGGG - Intergenic
1175847109 20:62065009-62065031 CGGCGGGGGCGGCGGGCGCGGGG + Exonic
1175859884 20:62144205-62144227 CAGCGCGCGCCGCGGACTCGGGG - Intronic
1175902986 20:62367283-62367305 CAGCGCGCGCGGCGGGAGCCCGG + Exonic
1175994117 20:62804783-62804805 AAGCGCGGGGGGCGGGCGGGGGG - Intergenic
1176128959 20:63488207-63488229 CGGCGCGCGGGGCGGGGGCGGGG + Exonic
1176159880 20:63642527-63642549 CCGCGCGCGAGGCAGGGACGGGG - Intronic
1176217885 20:63956785-63956807 CAGGGCGCGGGGCGGGGACGAGG + Exonic
1176237973 20:64063109-64063131 GGGCGCGGCAGGCGGGCGCGTGG + Intronic
1178961736 21:37072668-37072690 ATGCGCTCGAGGCGGGGGCGCGG - Exonic
1181017679 22:20080483-20080505 CCGCGGGCGGGGCGGGGGCGCGG + Intronic
1181793032 22:25282726-25282748 CGGCGCGCGAGGCGGCGGAGCGG + Intergenic
1181831632 22:25564874-25564896 CAGAGCGCTAGTGGGGCGCGCGG + Exonic
1182222961 22:28773054-28773076 CAGGGCGCAGGGCGGGCGGGCGG + Intronic
1183294050 22:37019549-37019571 CCGGGCGCGAAGCGGCCGCGCGG - Intronic
1183524976 22:38317409-38317431 GAGCGCGCGAGCCGGCGGCGGGG - Intronic
1183650887 22:39152705-39152727 CAGGGCGCGAGCCGAGCCCGCGG - Intergenic
1183683651 22:39349850-39349872 CAGCTCGCGGGGCGCGGGCGGGG - Intergenic
1183702151 22:39457050-39457072 CAGCACGCGCGGGCGGCGCGGGG + Intergenic
1184086919 22:42270735-42270757 CGGGGCGCGCGGCGGGGGCGGGG + Intronic
1184663786 22:45977223-45977245 CGGCGAGCGAGGAGGGCGGGCGG - Intergenic
1203259583 22_KI270733v1_random:166673-166695 CTGGGCCCGAGGCGGGCGTGGGG + Intergenic
949461989 3:4303544-4303566 CGGCGCGGGAGGCGGGCGCGCGG + Intronic
950530348 3:13549310-13549332 CAGCCCGCGAGGCGCGTCCGAGG - Intronic
951543669 3:23806195-23806217 CAGGGCACGGGGCCGGCGCGGGG + Intronic
953562087 3:43999314-43999336 GAGCGGGCGAGCCGGGCGGGAGG - Intergenic
953909175 3:46883183-46883205 CGGCGCGGGAGGGGGGCGGGGGG + Intronic
954025632 3:47781448-47781470 CAGAGCGGGCGGCGGGGGCGTGG + Intronic
954367594 3:50154826-50154848 CCGCCCGCGAAGCGGGGGCGGGG + Intergenic
954778883 3:53045363-53045385 CGGAGCGCGGGGCGCGCGCGGGG + Intronic
956681470 3:71785327-71785349 TGGCGCCCGAGGCGGGGGCGCGG - Intergenic
956825882 3:72996754-72996776 CGGAGCGCGCGGCGGGAGCGAGG + Intronic
961236867 3:125375021-125375043 CGGCGCGCGGGGGGAGCGCGCGG - Intronic
961365186 3:126395059-126395081 CAGGGCCCGAGGGGCGCGCGTGG + Intronic
962820613 3:139044577-139044599 CAGGGCGCAAGGCAGGCGCTGGG + Exonic
963741583 3:149086701-149086723 CCGCCCCCAAGGCGGGCGCGCGG + Intergenic
968010436 3:195270846-195270868 CAGCGCGGGCGGCGAGGGCGCGG + Exonic
968090555 3:195895940-195895962 CTGCGCGGGAGGCGGGCGCTGGG - Intronic
968148246 3:196317892-196317914 GAGGCCGCGAGGCGGGCGGGCGG - Intronic
968556545 4:1248836-1248858 CCGCGCGGGCGGGGGGCGCGGGG - Intronic
969240441 4:5893315-5893337 CAGGGCGCGAGGAGAGCGCGGGG + Intergenic
969295657 4:6269583-6269605 CCGCGGGCGGGGCGGGGGCGGGG + Intergenic
969344731 4:6563632-6563654 CGGCGGGCGCGGCGGGGGCGCGG + Intergenic
969370244 4:6727323-6727345 CAGCCCGGGAGCCGGGGGCGTGG + Intergenic
970399403 4:15703221-15703243 CGGCGGGCGGGGCGCGCGCGCGG + Exonic
973888446 4:55346311-55346333 CAGCGCGGAAGGCGGGCACGCGG + Exonic
977607222 4:98995549-98995571 GCGCGCGCGGGGCGGGGGCGGGG + Intergenic
978777372 4:112516787-112516809 CTGCGCGCGCGCCGGGCGGGGGG - Intergenic
982573292 4:157076457-157076479 CTGCGCGGGAGAGGGGCGCGGGG + Intronic
983576969 4:169270835-169270857 TAGGGCGCGCGGCCGGCGCGGGG - Intronic
984888674 4:184473320-184473342 GAGCGGGCGAGGTGGGGGCGGGG - Intronic
984888697 4:184473365-184473387 CAGCGCGCGAGGCCGGCCGGGGG + Intronic
984964280 4:185127509-185127531 CGGCGCGCGTGGCGCGGGCGCGG - Intergenic
986330523 5:6713665-6713687 CGCGGCGCGGGGCGGGCGCGGGG - Intergenic
990910216 5:60844442-60844464 CAGGGCGCGCGGCGGAGGCGAGG - Intergenic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
997297464 5:132777065-132777087 CGGCGCGCGCGGGAGGCGCGGGG - Intronic
997870137 5:137499107-137499129 CAGCCCCCTAGGCGGCCGCGGGG + Intronic
998199495 5:140108136-140108158 GCGCGCGCGAGACAGGCGCGAGG - Intronic
1000071357 5:157743797-157743819 CCGCGGGCTGGGCGGGCGCGCGG - Exonic
1001556630 5:172641453-172641475 CTGCCCGGGAGGCGGGCGCCGGG + Intronic
1002058098 5:176610145-176610167 CGGGGCGCGGGGCGGGAGCGCGG - Intergenic
1002902242 6:1418740-1418762 CAGAGCACGAGGCGAGCCCGGGG - Intergenic
1003603639 6:7541424-7541446 CACCGGGCGGGGCGGGGGCGGGG - Intergenic
1003882572 6:10491673-10491695 CGGCGCTCGTGGCCGGCGCGCGG + Intergenic
1003942712 6:11044474-11044496 CGCCGCGCCAGGAGGGCGCGCGG + Intergenic
1004043902 6:12009020-12009042 CAGCGCGCGCGGAGGGCGGAGGG + Intronic
1006369212 6:33633808-33633830 CTGGGGGCGGGGCGGGCGCGGGG + Intronic
1006369217 6:33633819-33633841 GCGGGCGCGGGGCGGGCGCGGGG + Intronic
1006737544 6:36285262-36285284 CAGCGTGCGTGGTGGGCGCGCGG - Intronic
1010083067 6:71886630-71886652 CGGGGCGCGGGGCGGGGGCGGGG - Intergenic
1011128946 6:84034499-84034521 CGGGGCGCGGGGCGGGCGGGGGG - Intronic
1014233864 6:118934515-118934537 CAGCCCGCGCGGAGGGGGCGGGG - Intronic
1015880590 6:137867109-137867131 CAGGGGGCGAGGGGCGCGCGCGG - Intergenic
1017962477 6:159233791-159233813 TGGCGCGCGCGGCGTGCGCGGGG - Exonic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019474373 7:1236832-1236854 CGGCGCGGGCGGCGGGGGCGCGG - Exonic
1020085549 7:5308304-5308326 TAGCGCGCGCTGCGGGCACGCGG + Exonic
1020234985 7:6348514-6348536 CCGCGGGCGAGGCGGGCGCTCGG + Intronic
1020461768 7:8435404-8435426 CAGCTGGGGAGGCGGGCGGGCGG - Intronic
1022427889 7:30285325-30285347 CAGCGCGCGGGCCCGGCCCGGGG + Exonic
1022715156 7:32891898-32891920 GAGAGCGCGCGGCGGGGGCGGGG - Intronic
1022715186 7:32891993-32892015 GCGCGCGCGAGGCGGGAGGGCGG - Intronic
1023638849 7:42238109-42238131 CGGCGCGCCGGGAGGGCGCGGGG - Intergenic
1024537541 7:50450432-50450454 CGGCGCGCGGGGCGTGGGCGCGG + Intronic
1030598062 7:111562531-111562553 CAGCGCGCGACGGGGCAGCGGGG - Intergenic
1033705563 7:143882629-143882651 CAGGGCGGGAGGCCGGGGCGGGG - Intronic
1034590110 7:152131495-152131517 CAGAGCGTGAGGATGGCGCGGGG + Intergenic
1034969380 7:155409549-155409571 CAGCACGCGAGGCGGGCTGTGGG + Intergenic
1037260440 8:17001873-17001895 GAGCGCGCGCGGCGGGCCGGGGG - Exonic
1038566461 8:28623223-28623245 CAGCGCGCGAGGCGGGCGCGTGG - Intronic
1038761135 8:30384833-30384855 CAGGGCGCGGGCCGGGAGCGGGG - Exonic
1038883667 8:31640295-31640317 CGGCGGGCGAGGCAGGGGCGTGG + Intronic
1039947272 8:42140614-42140636 CAGCGCGGGTGGCGGGCGCGGGG - Intergenic
1042591683 8:70403333-70403355 CAGCCCGCGGCGCGGGCGAGAGG - Intronic
1049467635 8:142759394-142759416 CAGCGGACGAGGTGGGGGCGGGG - Intergenic
1049838515 8:144755332-144755354 GAGGGCGCGGGGAGGGCGCGGGG - Intronic
1050357061 9:4793243-4793265 CGGCGCGCGGCGTGGGCGCGGGG + Intronic
1050744227 9:8858043-8858065 CAGCGAGAGAAGCGGGCGCAGGG - Intronic
1051079613 9:13279336-13279358 CGGCGCGCGCGCAGGGCGCGGGG + Intronic
1051174015 9:14346121-14346143 CCGCGGGCGCGGGGGGCGCGTGG + Intronic
1055611807 9:78031692-78031714 GAGCGGGCGCGCCGGGCGCGGGG - Intergenic
1055611830 9:78031763-78031785 CTGCGCGCGAGCCGGGCGGTGGG - Intergenic
1056992287 9:91423572-91423594 CAGGGCGCGCTGCGGGCGGGCGG - Intronic
1057313476 9:93955306-93955328 CAGGGCGCGGGCGGGGCGCGCGG + Exonic
1057432238 9:95004961-95004983 CGGCGCGGGCGGCGGGCGCGGGG - Intronic
1059305336 9:113349555-113349577 GAGCGCACGGGGCGGGCGCACGG + Exonic
1059375138 9:113875902-113875924 GAGCGGGCGCGGGGGGCGCGGGG + Intergenic
1060109257 9:120894744-120894766 GAACCCGCGGGGCGGGCGCGAGG - Intronic
1060283492 9:122228885-122228907 CTGCGCGCGGGCCGGGGGCGGGG - Intronic
1060849219 9:126860768-126860790 CAGCGGGCTAGGCGCGGGCGGGG + Intronic
1060945888 9:127569148-127569170 CAGCGGGCGGGGAGGGGGCGGGG - Intronic
1061089953 9:128420865-128420887 CAGCGCGCATGGCGGGCGCTTGG - Exonic
1061149121 9:128818943-128818965 CAGAGCGCGCCGCGGGTGCGCGG - Exonic
1061275921 9:129569259-129569281 CAGGGCCCGAGGAGGGGGCGGGG + Intergenic
1061489836 9:130938825-130938847 CAGCGCGAGCGGCGGGCGTTGGG - Exonic
1061666251 9:132162256-132162278 GAGCCCGGGAGGCGGGCGGGGGG + Intronic
1062341557 9:136095716-136095738 CAGGGCGCGCGCCGGGGGCGGGG - Intergenic
1062659158 9:137619241-137619263 AAGCGCGCCCGGCGGGAGCGCGG - Intronic
1185892750 X:3835415-3835437 CAGCAGGCGTGGCGGGCACGGGG + Intronic
1185897858 X:3873835-3873857 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1185902977 X:3912266-3912288 CAGCAGGCGTGGCGGGCACGGGG + Intergenic
1189310629 X:40014936-40014958 CGGAGCGCGGGGCGGGGGCGGGG - Intergenic
1189324991 X:40106538-40106560 GAGGGCGGGAGGCGGGAGCGCGG - Intronic
1189988648 X:46574902-46574924 CAGCGCGCGAGACTGGCCCCCGG - Exonic
1192467358 X:71366687-71366709 GAGAGCGCGAGGCGAGCCCGGGG + Intronic
1199736784 X:150693301-150693323 CGGCGCGCGGGGCCGGCGCCGGG - Intronic
1200058736 X:153474694-153474716 CAACGGGAGAGGCGGGGGCGGGG + Intronic
1200081677 X:153579934-153579956 CAGGGCGCGAGGTGGGAGCAGGG - Intronic
1200217531 X:154374678-154374700 CCGGGCGCGGGGCGGGCGCGGGG - Intergenic
1200277777 X:154750884-154750906 CCGCCCGCGGGGCGGCCGCGGGG - Intronic