ID: 1038566463

View in Genome Browser
Species Human (GRCh38)
Location 8:28623230-28623252
Sequence CTCCTGACAGCGCGCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566463_1038566473 10 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG No data
Right 1038566473 8:28623263-28623285 CGTGGGTAAGCCCGTGCCGTGGG No data
1038566463_1038566467 -8 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG No data
Right 1038566467 8:28623245-28623267 GTCAGGAGGCGCTGTCCCCGTGG No data
1038566463_1038566472 9 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG No data
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566463_1038566468 -7 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG No data
Right 1038566468 8:28623246-28623268 TCAGGAGGCGCTGTCCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566463 Original CRISPR CTCCTGACAGCGCGCGAGGC GGG (reversed) Intronic