ID: 1038566463

View in Genome Browser
Species Human (GRCh38)
Location 8:28623230-28623252
Sequence CTCCTGACAGCGCGCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566463_1038566467 -8 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1038566467 8:28623245-28623267 GTCAGGAGGCGCTGTCCCCGTGG No data
1038566463_1038566468 -7 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1038566468 8:28623246-28623268 TCAGGAGGCGCTGTCCCCGTGGG No data
1038566463_1038566473 10 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1038566473 8:28623263-28623285 CGTGGGTAAGCCCGTGCCGTGGG No data
1038566463_1038566472 9 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566463 Original CRISPR CTCCTGACAGCGCGCGAGGC GGG (reversed) Intronic
901184911 1:7366743-7366765 CTCCTGTCAACGCACAAGGCTGG - Intronic
902916730 1:19644234-19644256 CTCCAAACAGGGCGCGAGGGCGG - Intronic
915433543 1:155885878-155885900 CTCCTGACAGGCCTTGAGGCCGG - Intergenic
1067030851 10:42878214-42878236 CTCCTGACATAGCTCCAGGCAGG - Intergenic
1070305008 10:75234716-75234738 CTGCTGGCGGCGGGCGAGGCCGG - Exonic
1070934581 10:80283369-80283391 GTGCTGACAGCAGGCGAGGCTGG - Intronic
1074618337 10:115093020-115093042 CTCCAGTCAGCGCGCGGGCCAGG + Intergenic
1075031856 10:119029496-119029518 CGCCCGACAGCTGGCGAGGCTGG + Intergenic
1075872653 10:125782051-125782073 CTCCTGCCTGCGGGTGAGGCTGG - Intergenic
1077581807 11:3422198-3422220 CTCCCGCCAGCTCGCGGGGCAGG + Intergenic
1078663209 11:13303807-13303829 CTCCTGACTGCAAGGGAGGCTGG + Intronic
1083445583 11:62706258-62706280 GCCCTGGCAGCGCGCGAGGCTGG - Intronic
1085303313 11:75471363-75471385 CTCCTGACAGCCTAAGAGGCTGG + Intronic
1089700208 11:120240083-120240105 CTCCTGCCAGGGGGCGTGGCCGG + Intronic
1090031744 11:123212199-123212221 TTCCTGTCAGCCCGTGAGGCTGG + Intergenic
1090699213 11:129279347-129279369 AGCCTGACGGGGCGCGAGGCGGG - Intergenic
1091010584 11:131997245-131997267 CTCCAGGCAGGGCGAGAGGCTGG - Intronic
1091079794 11:132655580-132655602 CGCCTGAAAGCACGCGAGGAGGG + Intronic
1096867048 12:54570800-54570822 CTCTTGACAGGGCTCGGGGCGGG + Intronic
1097838410 12:64296970-64296992 CTTCTGACAGCTCTGGAGGCAGG - Intronic
1102583633 12:113908112-113908134 CTCCTGAGAGCCAGCCAGGCAGG - Intronic
1103932180 12:124456813-124456835 CTCCTCACAGCCCGAGCGGCCGG + Intronic
1104862243 12:131929731-131929753 CTCCCAACAGCGCGCGAAGCTGG - Exonic
1107250153 13:38350177-38350199 CTCCTGGAAGGGCGCGAGCCAGG - Exonic
1112504446 13:99968017-99968039 CTCCCGAGAGAGCGCGAGTCGGG + Intronic
1120900665 14:89572941-89572963 CTCCTGGCAGAGAGGGAGGCAGG + Intronic
1124103036 15:26713176-26713198 CTCCTGAGAGCGGCTGAGGCAGG + Intronic
1125516401 15:40323631-40323653 CTGTTGCCGGCGCGCGAGGCGGG + Intergenic
1125722893 15:41853587-41853609 TTCCTGGCAGCGCCCGAGGAAGG + Exonic
1132496728 16:266879-266901 CCCCTGACAGCACGGGAGGGAGG + Intronic
1137711270 16:50568462-50568484 CTCCTGAAAGCCCATGAGGCAGG - Intronic
1140411541 16:74743883-74743905 CTACTGACACCGCGTGACGCTGG - Intronic
1147705328 17:42421912-42421934 CTCCTGGAAGCGGGCGGGGCTGG - Intronic
1149461453 17:56833413-56833435 CGCCCGCCAGCGCCCGAGGCCGG - Intronic
1162577179 19:11505804-11505826 CTCCTAACAACGGGGGAGGCTGG - Exonic
1163070591 19:14837492-14837514 CTCCTTACAGTGCACGTGGCTGG - Intergenic
1163657789 19:18557822-18557844 ATCCTGCGAGCGCGCGTGGCGGG - Intronic
1166785297 19:45363714-45363736 CCCCAGACAGCGCGCGGGGTGGG - Intronic
1168665929 19:58204756-58204778 GTCCTAACACCGCGCGGGGCAGG + Intronic
926736095 2:16074296-16074318 CTCCTCACAGCACGCCATGCGGG - Intergenic
931538017 2:63299959-63299981 CTCCTTACAGCACACGTGGCTGG - Intronic
940775215 2:157876757-157876779 CTCCCGAGGGCGCGCGGGGCAGG + Intronic
948598116 2:239093384-239093406 CTCCTGACACCCCAGGAGGCTGG + Intronic
1169388805 20:5172969-5172991 CTCCAGACAACGCTCGAGCCAGG - Intronic
1171881628 20:30621692-30621714 CTCCTGACAGTGAGTGAGGTTGG - Intergenic
1175950109 20:62578847-62578869 CACCTGACAGCCGGAGAGGCTGG + Intergenic
1176047669 20:63101158-63101180 CTCCTGACAGAGAGGGAGGGAGG + Intergenic
1180042667 21:45288157-45288179 CTCCTGAGGGTCCGCGAGGCCGG + Intergenic
1181486628 22:23235717-23235739 CTCCTCACAGTGCTGGAGGCAGG + Intronic
1181832222 22:25569925-25569947 CACCTGACAGTGGGAGAGGCAGG + Intronic
1184587955 22:45460514-45460536 CTCCTGGCTGCGCAGGAGGCTGG - Intergenic
952741326 3:36737812-36737834 CTCCTGAGAGAGCACCAGGCGGG - Exonic
955037623 3:55284259-55284281 CTCCTGACAGCGACAGCGGCTGG + Intergenic
962254070 3:133858437-133858459 CTCCTCACAGCTCTGGAGGCTGG + Intronic
962384655 3:134923097-134923119 CTTCTGACAGCTGGGGAGGCTGG - Intronic
964619577 3:158707626-158707648 CTCCTGAAAGTGCATGAGGCTGG + Intronic
965558129 3:170038068-170038090 CTCCCGGGAGCGCGCGGGGCGGG + Exonic
967844905 3:194035603-194035625 CTCCTGCCAGCCTGCAAGGCAGG - Intergenic
980378249 4:131976942-131976964 CTCCTGAAAACCTGCGAGGCAGG + Intergenic
992104251 5:73436946-73436968 CCCCCGACAGCATGCGAGGCCGG - Intergenic
994367147 5:98928988-98929010 TTCCCGACAGAGCGCGAGGCGGG + Intergenic
999318845 5:150601072-150601094 CTCCAGACAGAGCGCGAGTGAGG + Exonic
1002586008 5:180248618-180248640 CTCCTCGCAGCCCACGAGGCTGG - Intronic
1005380493 6:25229379-25229401 CTCCTCACAGTGCTGGAGGCTGG - Intergenic
1005627826 6:27680171-27680193 CTCCTGGCAGCGAGCAAGGCCGG + Intergenic
1014466029 6:121758275-121758297 CTCCTAACAGCGTGTGATGCAGG - Intergenic
1019339770 7:503497-503519 CTCCTGACTGCCTGGGAGGCAGG - Intronic
1024231735 7:47368429-47368451 CTCCAGACAGCGTGGGAGGTGGG - Exonic
1027312853 7:76966028-76966050 CTCCTGGCAGCGCCCAGGGCAGG - Intergenic
1030113074 7:106042766-106042788 CTCCTGCCAGCCCCCCAGGCAGG - Intergenic
1038566463 8:28623230-28623252 CTCCTGACAGCGCGCGAGGCGGG - Intronic
1041437332 8:57856877-57856899 CTCCTCACAGCTCCAGAGGCTGG - Intergenic
1042720101 8:71818296-71818318 CTCCTGACAGCTCTTGAGGAGGG - Intergenic
1047423534 8:124726929-124726951 CTCCAGCCAGCTCGCGCGGCTGG + Intronic
1047764765 8:127981387-127981409 CTCCTGACAGGGCACCAGGAAGG + Intergenic
1047998512 8:130358369-130358391 CTCCAAGCCGCGCGCGAGGCAGG + Intronic
1049047733 8:140165960-140165982 CTCCAGACATCGAGGGAGGCAGG - Intronic
1053003295 9:34589599-34589621 CCCCCGGCAGCGAGCGAGGCAGG + Exonic
1057592422 9:96383762-96383784 CCCCTGCGAGCGCCCGAGGCCGG + Intergenic
1061390705 9:130315693-130315715 CTCCTCACAGCTCTGGAGGCTGG + Intronic
1196754526 X:119146676-119146698 CTCCTTACAGAGGGTGAGGCTGG + Intronic