ID: 1038566464

View in Genome Browser
Species Human (GRCh38)
Location 8:28623231-28623253
Sequence CCTCCTGACAGCGCGCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566464_1038566473 9 Left 1038566464 8:28623231-28623253 CCGCCTCGCGCGCTGTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1038566473 8:28623263-28623285 CGTGGGTAAGCCCGTGCCGTGGG No data
1038566464_1038566467 -9 Left 1038566464 8:28623231-28623253 CCGCCTCGCGCGCTGTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1038566467 8:28623245-28623267 GTCAGGAGGCGCTGTCCCCGTGG No data
1038566464_1038566472 8 Left 1038566464 8:28623231-28623253 CCGCCTCGCGCGCTGTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566464_1038566468 -8 Left 1038566464 8:28623231-28623253 CCGCCTCGCGCGCTGTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1038566468 8:28623246-28623268 TCAGGAGGCGCTGTCCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566464 Original CRISPR CCTCCTGACAGCGCGCGAGG CGG (reversed) Intronic
922795074 1:228335780-228335802 CCTCCTGACAGTGCCTAAGGTGG + Exonic
1064033007 10:11894799-11894821 CCTCCGGAAAGCGGGGGAGGAGG + Intergenic
1075229800 10:120666161-120666183 CCTCCTGACAGGCCGAGAGATGG - Intergenic
1076883154 10:133249304-133249326 CCTCCTGATGGCCCCCGAGGCGG + Intergenic
1084789141 11:71462564-71462586 ACTCCTGACACAGCCCGAGGGGG - Intronic
1089672696 11:120067537-120067559 CCTCCTGTCAGCAGGCGAGAGGG - Intergenic
1091079793 11:132655579-132655601 ACGCCTGAAAGCACGCGAGGAGG + Intronic
1091950681 12:4590641-4590663 CCTCCTGACAGCTCTAGAGAGGG - Intronic
1104081465 12:125434097-125434119 CCTCCTGACAGCTCTCTGGGAGG + Intronic
1104568360 12:129904132-129904154 CCTCCTGCCAGCAGGCGCGGGGG + Intergenic
1107604117 13:42041084-42041106 GCTCCAGGCGGCGCGCGAGGAGG - Intronic
1114602788 14:23969833-23969855 CCTCCTGAGAGCCCGCGGGCTGG - Intergenic
1114607156 14:24006962-24006984 CCTCCTGAGAGCCCGCGGGCTGG - Intergenic
1124600446 15:31129017-31129039 CCTCCTGCAAGCTCCCGAGGAGG - Intronic
1125516400 15:40323630-40323652 CCTGTTGCCGGCGCGCGAGGCGG + Intergenic
1128800568 15:70494335-70494357 CCTCCTGACAACCCGGGATGAGG + Intergenic
1130647425 15:85741288-85741310 CCTCCTGGCCCAGCGCGAGGAGG + Exonic
1136272715 16:29158159-29158181 TCTCCTCACAGCGCGCACGGCGG - Intergenic
1137037516 16:35578934-35578956 CCTCCTGGCAGCACTTGAGGAGG + Intergenic
1141482002 16:84313050-84313072 CCGCCTGACAGCGCGCGGCCTGG - Exonic
1142201928 16:88765221-88765243 CCTCCTGCCTGCGAGGGAGGTGG - Intronic
1145885788 17:28381650-28381672 CCACCAGACAGCGGGCGAAGCGG - Exonic
1145970059 17:28951140-28951162 CCTCCCGACGGGCCGCGAGGGGG + Exonic
1147861242 17:43524933-43524955 CCTCCTCACAGCTCCTGAGGAGG + Exonic
1151185228 17:72359323-72359345 CCTCCTGACTGCCTGCAAGGAGG + Intergenic
1155369730 18:25085107-25085129 TCTCCTGGCAGCACGCTAGGTGG + Intronic
1162914305 19:13865814-13865836 ACACCTGACCGCGCGCGGGGAGG + Intronic
1165234359 19:34408618-34408640 CTTCCTGACAGCAGGAGAGGTGG - Intronic
1166785299 19:45363715-45363737 GCCCCAGACAGCGCGCGGGGTGG - Intronic
1167376542 19:49115054-49115076 CCTCCCGGCAGCTCCCGAGGCGG + Intronic
925234138 2:2263276-2263298 CCTACTGGCAGAGAGCGAGGAGG + Intronic
930016614 2:46975016-46975038 CCGCCTGACAGAGAGGGAGGAGG + Exonic
936278294 2:111118858-111118880 CCTCCCGACGGCGCGGGAGAAGG + Intergenic
1170555154 20:17508969-17508991 GCTCCTGACGGAGCGGGAGGTGG - Exonic
1173109713 20:40175357-40175379 CCTCATGACAGCGTCCAAGGTGG - Intergenic
1175949504 20:62575847-62575869 CCTCCTGACCGGGCCCGGGGCGG + Intergenic
1176247046 20:64102361-64102383 CCTCCTGACACGGGGCGGGGTGG - Intergenic
1178855337 21:36245820-36245842 CCTCCTGGTGGCGAGCGAGGAGG - Exonic
1180954800 22:19736858-19736880 CATCCTGACAGCGGGCGGTGAGG - Intergenic
1183520429 22:38293596-38293618 CCTCCTGCCTGTGGGCGAGGAGG - Intronic
1183701394 22:39453239-39453261 CCACCTGACAGCGTGTGGGGAGG - Intergenic
953447285 3:42979256-42979278 TCCCCTGAAAGCGCGGGAGGGGG - Intronic
963335620 3:143971478-143971500 CCTCTGGACGGCGCGCGAGGCGG - Intergenic
965558128 3:170038067-170038089 CCTCCCGGGAGCGCGCGGGGCGG + Exonic
972536519 4:40004604-40004626 CCTGCTGACAGCGCGAGACTCGG - Intergenic
972960774 4:44448953-44448975 ACTCCTGGCAGCACGGGAGGAGG + Intergenic
983608828 4:169620265-169620287 GCTGCTGACCTCGCGCGAGGCGG - Intronic
984708461 4:182864799-182864821 CCTCCTGCCATCTCCCGAGGAGG + Intergenic
994367146 5:98928987-98929009 CTTCCCGACAGAGCGCGAGGCGG + Intergenic
1006945980 6:37784736-37784758 CCGCCTGGCAGCGAGGGAGGGGG + Intergenic
1011734316 6:90296544-90296566 CCTCCCGGCAGCCGGCGAGGTGG + Exonic
1012227418 6:96720047-96720069 CCTTCTGATAGAGCGCAAGGAGG + Intergenic
1019033571 6:169034672-169034694 CCTTCTGACATCGCATGAGGAGG - Intergenic
1023045826 7:36209396-36209418 CCTCCTCACAGGGCACCAGGTGG - Intronic
1024231736 7:47368430-47368452 TCTCCAGACAGCGTGGGAGGTGG - Exonic
1026968695 7:74455053-74455075 CCTCCTGGCAGTGCTGGAGGGGG + Intronic
1033421946 7:141211420-141211442 CCTGCTGACAGTGGGCTAGGGGG + Intronic
1038566464 8:28623231-28623253 CCTCCTGACAGCGCGCGAGGCGG - Intronic
1042720102 8:71818297-71818319 TCTCCTGACAGCTCTTGAGGAGG - Intergenic
1051668183 9:19484773-19484795 CCTCCTGACAGAGCTGGAGATGG - Intergenic
1060268726 9:122127024-122127046 CCACCTGGCGGCGCTCGAGGGGG - Intergenic
1203786866 EBV:133107-133129 CATCCTGCCAGCGGGAGAGGAGG - Intergenic
1195369255 X:104156880-104156902 CGCCATGACAGCGAGCGAGGCGG - Exonic