ID: 1038566466

View in Genome Browser
Species Human (GRCh38)
Location 8:28623234-28623256
Sequence GCGCCTCCTGACAGCGCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566466_1038566473 6 Left 1038566466 8:28623234-28623256 CCTCGCGCGCTGTCAGGAGGCGC 0: 1
1: 0
2: 1
3: 6
4: 63
Right 1038566473 8:28623263-28623285 CGTGGGTAAGCCCGTGCCGTGGG No data
1038566466_1038566472 5 Left 1038566466 8:28623234-28623256 CCTCGCGCGCTGTCAGGAGGCGC 0: 1
1: 0
2: 1
3: 6
4: 63
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566466 Original CRISPR GCGCCTCCTGACAGCGCGCG AGG (reversed) Intronic
901086491 1:6614599-6614621 CCGCCCCCTGACTCCGCGCGGGG + Intronic
902180284 1:14683081-14683103 GCGCCTGCTGACAGCGTGATGGG + Intronic
902227585 1:15006438-15006460 GTCCCTCCTGACAGCGAGCCGGG + Intronic
903125909 1:21247468-21247490 GCGCCATCTGACAGCGCACCGGG + Intronic
904831028 1:33306930-33306952 GCGCCTCCAGGCCGCGCGCGCGG + Exonic
916676347 1:167066878-167066900 GCGCCTCGGGGCAGCACGCGTGG - Intronic
922705402 1:227787943-227787965 GCGCCTCCTCAGAGCGCGTCTGG - Intergenic
1067084327 10:43229931-43229953 GCTCCTCCTGACAGCGCTCCAGG - Intronic
1067694422 10:48524443-48524465 GCGGCTCCTGGGAGAGCGCGCGG - Intronic
1069501423 10:68956419-68956441 GCGCGTCCAGACACCGGGCGTGG + Intronic
1070835667 10:79445575-79445597 GCGGCTGCGGGCAGCGCGCGGGG - Exonic
1081759020 11:45564146-45564168 GCCCCTGCTGACAGCCAGCGAGG - Intergenic
1081990180 11:47333363-47333385 ACGCCTCCTGACAGTGAGCAGGG + Intronic
1084667374 11:70583693-70583715 GAGGCTCCTGACAGTGAGCGTGG - Intronic
1089533789 11:119148980-119149002 GCGCCGCCCGGCAGCCCGCGGGG - Intergenic
1094125046 12:27014485-27014507 GCGCCTCCTGCCGGCGCGCGGGG + Intergenic
1095476217 12:42589679-42589701 CCGCCGCCCGACAGCGCGCCCGG - Intronic
1103400781 12:120641349-120641371 GCGCCTCCCGTCAGCGCTCCCGG + Intronic
1103749858 12:123151135-123151157 GCGCCTCCTCAGGCCGCGCGGGG + Intergenic
1108244686 13:48502737-48502759 GCGCCACGTGACGGCGGGCGTGG + Exonic
1114649034 14:24271483-24271505 GCGCCTCCTCCCAGCGCAGGTGG - Exonic
1121014673 14:90541360-90541382 GCGCCTGCTCAGAGCACGCGGGG + Exonic
1122905619 14:104800378-104800400 GCCCCTGCTGGCTGCGCGCGGGG + Intergenic
1128585296 15:68844072-68844094 GCGGCTCCTGAGAGCTCGCTGGG + Intronic
1132884875 16:2178282-2178304 GGGCCTCCTGCCCGCGCGGGAGG - Exonic
1141732567 16:85832858-85832880 GTGCCTCCTGACAGGACGAGGGG - Intergenic
1147705330 17:42421916-42421938 GGGCCTCCTGGAAGCGGGCGGGG - Intronic
1148262232 17:46193527-46193549 GCGCCCCCTGGCGGCGCGCCGGG - Intronic
1148262245 17:46193562-46193584 GCGCCTCCTGGCGGCCCGCGGGG - Intronic
1148437131 17:47693861-47693883 GCCCTTCCTGGCAGCGCGCCCGG - Intergenic
1151314020 17:73311148-73311170 GCGCCTCCTGGCGGGGTGCGGGG - Intronic
1154241706 18:12658427-12658449 GCGCCCCCCGACCGCGCGCCCGG - Intronic
1162738086 19:12757732-12757754 GCGCCTCCTGCCGGCGGGCGCGG + Exonic
1162914304 19:13865811-13865833 CCGACACCTGACCGCGCGCGGGG + Intronic
1162954579 19:14090986-14091008 GCGCCTCCTTAAAAAGCGCGCGG - Intronic
1166785300 19:45363718-45363740 GCGGCCCCAGACAGCGCGCGGGG - Intronic
927591278 2:24360229-24360251 GAGCCTCCGGGCAGCGGGCGCGG + Intronic
936104761 2:109614546-109614568 GCGCTTCCTGGCGGAGCGCGGGG + Exonic
937347124 2:121132995-121133017 GCGCCTCCTGATAGCTGGGGTGG - Intergenic
1171399142 20:24860399-24860421 GCGCCTACTGACAGCGTGGTAGG - Intergenic
1176012591 20:62907302-62907324 GCGCCACGTGACAGCACCCGGGG + Exonic
1178633236 21:34280681-34280703 GCGCCTGCAGACAGCGGGAGAGG - Intergenic
1180744422 22:18078024-18078046 TCGCCTCCCGGCAGCGGGCGCGG - Exonic
1181478124 22:23180919-23180941 GCGCCGCCGGGCTGCGCGCGGGG - Exonic
1181925428 22:26354872-26354894 GTGTCTCCTGACACCCCGCGTGG - Intronic
1182045514 22:27271024-27271046 GCTGCTCCTGACAGCGAGCCCGG + Intergenic
1185058564 22:48593654-48593676 GCGCCTTCTCACCGCGCGCTCGG + Intronic
950610905 3:14125915-14125937 GCGCCTCCTACCAGGGCGCTGGG + Intronic
956884447 3:73545151-73545173 GCGTCTCCTGACAGGGCCTGGGG + Intronic
965558124 3:170038064-170038086 GCCCCTCCCGGGAGCGCGCGGGG + Exonic
967296898 3:187974090-187974112 GCTCCTCCTGAAAGCTCGAGAGG - Intergenic
968082965 3:195859585-195859607 GGGCATCCTGACAGGGCACGGGG + Intergenic
992663576 5:78984834-78984856 GCCCCGCCTGCCAGCGCCCGCGG + Intronic
998517672 5:142770603-142770625 GCGCCGGCGGACACCGCGCGCGG + Exonic
1002416156 5:179121917-179121939 GCCCCTCCTGACAGCAGCCGGGG + Intronic
1002958714 6:1893904-1893926 GCGCCTCCTGCCAGCGGGGCTGG - Intronic
1014233874 6:118934526-118934548 GCGCGTCCCGCCAGCCCGCGCGG - Intronic
1018170533 6:161140056-161140078 GCTCCTCCTGACTGCGGGCCAGG - Intronic
1020270129 7:6589930-6589952 GCGCCCCCTGGCGGCGCGAGCGG - Intergenic
1026665428 7:72336742-72336764 GCGCCTCCGCACAGCGCGGGGGG + Intronic
1034979871 7:155468605-155468627 GCGGCTCCTCGCAGCGCGCTTGG - Intergenic
1038566466 8:28623234-28623256 GCGCCTCCTGACAGCGCGCGAGG - Intronic
1041022962 8:53657173-53657195 GCGCTTGCGGACAGCGTGCGGGG - Intergenic
1045269320 8:100648968-100648990 GCGCCGCCTGGCAGGGCGCTGGG - Intronic
1053489454 9:38488062-38488084 GAGCCGCCTGACGGCGCGCCTGG - Intergenic
1056814651 9:89792391-89792413 GCATCTCCTGACAGGGCCCGAGG + Intergenic
1057259630 9:93576560-93576582 GCCCCTCCAGCCAGCGCGCCCGG + Exonic
1057669797 9:97077382-97077404 GAGCCGCGTGACGGCGCGCGTGG - Intergenic
1061576073 9:131507399-131507421 GCGCCTGCTGCCAGCACTCGCGG + Exonic
1061595965 9:131629223-131629245 GCTCCCCCTGACAGACCGCGAGG - Exonic
1062578242 9:137218377-137218399 GCGCTTCCTGGCAGGGCCCGTGG + Intergenic