ID: 1038566472

View in Genome Browser
Species Human (GRCh38)
Location 8:28623262-28623284
Sequence CCGTGGGTAAGCCCGTGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038566463_1038566472 9 Left 1038566463 8:28623230-28623252 CCCGCCTCGCGCGCTGTCAGGAG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566466_1038566472 5 Left 1038566466 8:28623234-28623256 CCTCGCGCGCTGTCAGGAGGCGC 0: 1
1: 0
2: 1
3: 6
4: 63
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566464_1038566472 8 Left 1038566464 8:28623231-28623253 CCGCCTCGCGCGCTGTCAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data
1038566461_1038566472 16 Left 1038566461 8:28623223-28623245 CCACGCGCCCGCCTCGCGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038566472 Original CRISPR CCGTGGGTAAGCCCGTGCCG TGG Intronic
No off target data available for this crispr