ID: 1038568519

View in Genome Browser
Species Human (GRCh38)
Location 8:28639571-28639593
Sequence GAGGGGAAGTATAAAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 460}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038568519_1038568525 -5 Left 1038568519 8:28639571-28639593 CCTACCTCTTTATACTTCCCCTC 0: 1
1: 0
2: 0
3: 40
4: 460
Right 1038568525 8:28639589-28639611 CCCTCTTGGTCCCTGCGGTTTGG No data
1038568519_1038568531 30 Left 1038568519 8:28639571-28639593 CCTACCTCTTTATACTTCCCCTC 0: 1
1: 0
2: 0
3: 40
4: 460
Right 1038568531 8:28639624-28639646 GTTGAGCCACTCCCTCCACCTGG No data
1038568519_1038568522 -10 Left 1038568519 8:28639571-28639593 CCTACCTCTTTATACTTCCCCTC 0: 1
1: 0
2: 0
3: 40
4: 460
Right 1038568522 8:28639584-28639606 ACTTCCCCTCTTGGTCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038568519 Original CRISPR GAGGGGAAGTATAAAGAGGT AGG (reversed) Intronic
903776511 1:25797544-25797566 GGGGGGAAGTGTGAAGAGGGAGG - Intergenic
906049360 1:42857742-42857764 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
906257134 1:44359065-44359087 GAGGGGCAGGAGAAAGGGGTAGG - Intergenic
906462718 1:46048650-46048672 GAGGCTCAGTTTAAAGAGGTTGG - Intronic
906914339 1:49992620-49992642 GAGGGAAAGTATTGAAAGGTAGG - Intronic
907282190 1:53357278-53357300 GAGGGGAAGTAAAGAGAGAAAGG + Intergenic
907376949 1:54052257-54052279 GGGGGGAAGCATAGAGAGGAGGG + Intronic
907578845 1:55553780-55553802 GAGGGGGAGAAAAAAGGGGTTGG - Intergenic
907606595 1:55824002-55824024 GAGGGTAAGAATAAAGAACTTGG - Intergenic
907760499 1:57353864-57353886 GAGGCGAAGTATAAAAATGAAGG + Intronic
907958157 1:59251345-59251367 GAGGTGGAGTCTAAAGAGGCAGG - Intergenic
908920208 1:69181561-69181583 TAAGGAAAGTATAAAGAGTTAGG - Intergenic
909781736 1:79557325-79557347 GTGGGATGGTATAAAGAGGTGGG - Intergenic
909949594 1:81704100-81704122 GAGGGGAAGTATGATGATGAAGG - Intronic
910400064 1:86829471-86829493 GTGTGGTAGTATTAAGAGGTGGG + Intergenic
910627676 1:89325665-89325687 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
911074135 1:93856264-93856286 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
911751383 1:101501102-101501124 GAGGGGACATGTACAGAGGTTGG - Intergenic
911809708 1:102260424-102260446 GAGAGGAAGTACGAAGAGGAGGG + Intergenic
912977121 1:114341033-114341055 TAGTGGCAGTATTAAGAGGTGGG - Intergenic
913077338 1:115352214-115352236 GAGGGAAGGTAGAATGAGGTGGG - Intergenic
913581048 1:120227155-120227177 TAGAGGAATTATAAAGAGGCAGG - Intergenic
913627128 1:120671245-120671267 TAGAGGAATTATAAAGAGGCAGG + Intergenic
913721792 1:121603766-121603788 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
914562978 1:148838592-148838614 TAGAGGAATTATAAAGAGGCAGG - Intronic
914609849 1:149291630-149291652 TAGAGGAATTATAAAGAGGCAGG + Intergenic
915075518 1:153305596-153305618 GAGAGAAATTATAAAGAGGCAGG - Intronic
915214495 1:154330724-154330746 CTGGGGAAGTATAAAGATGGGGG + Intronic
915473428 1:156138911-156138933 GAGGGGCAGGATGCAGAGGTGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916774244 1:167943664-167943686 GAGTGGAAGAATGAGGAGGTGGG - Intronic
917075190 1:171197634-171197656 ATGGGGCAGTATGAAGAGGTGGG + Intronic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918518292 1:185386647-185386669 GGGGGGCAGTATAAAGTGGCAGG + Intergenic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919465269 1:197917641-197917663 GAGGGGAAGCAAAAAGAACTGGG - Exonic
919958609 1:202442955-202442977 GAGGGACACTATAAAGTGGTGGG + Intronic
920589895 1:207207266-207207288 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
921092934 1:211860264-211860286 GAGGGGAAGACTAAAGAGGATGG + Intergenic
921258128 1:213361153-213361175 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
922075988 1:222245106-222245128 GAGGCTAAGAGTAAAGAGGTAGG + Intergenic
922368288 1:224886297-224886319 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
923801042 1:237208852-237208874 GAGGGGAAATACAAAGATGTTGG - Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063430983 10:5988064-5988086 TAGGGGAATTACAAAGAGGAGGG - Intergenic
1063880378 10:10525481-10525503 GAGGGGAATTAGAAAGATGTTGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067561411 10:47307295-47307317 GAGGGGAAGAAAAGAGAGGAGGG + Intronic
1067845349 10:49715458-49715480 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1068080531 10:52313581-52313603 GATGGGAAGTTTAGAGAGGGAGG - Intergenic
1069227163 10:65958988-65959010 GAGGTGAAGTCTACAGAGGCAGG + Intronic
1069310340 10:67027268-67027290 GAGGGGAATTAAAAAGATCTAGG - Intronic
1069369182 10:67725642-67725664 GAGGGAAAAAATAAAGAGATAGG + Intergenic
1070851876 10:79570890-79570912 GAGGCGGAGTCTACAGAGGTAGG - Intergenic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071024344 10:81094026-81094048 GAGGGGAGGTAGGAAGAGGTTGG - Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071884703 10:89937118-89937140 GAGGTGGAGTCTACAGAGGTGGG + Intergenic
1072226953 10:93379351-93379373 GAGGGGAGGATTAAAAAGGTAGG - Intronic
1072479453 10:95796719-95796741 AAGGGGAAGTACCTAGAGGTGGG + Intronic
1072532184 10:96329941-96329963 GATGGGAAGGATGGAGAGGTGGG + Intronic
1072820798 10:98555301-98555323 GAGGGGAGGCATAAAAAGGGTGG - Intronic
1074100675 10:110352576-110352598 GAGGGAAAGTACAAGTAGGTAGG + Intergenic
1075858076 10:125648048-125648070 GAGGTGAAGTCTACAGAGGCAGG - Intronic
1076182785 10:128423467-128423489 CAGGAGAAGTATAAAGACGAAGG + Intergenic
1079232332 11:18659322-18659344 GAGGTGGAGTCTAAAGAGGCAGG - Intergenic
1080419042 11:32093964-32093986 GAGGGGGAGAAGAGAGAGGTAGG + Intronic
1080541746 11:33272814-33272836 GAGGGGAGGAAGAAAGAGGGAGG - Intronic
1081514959 11:43819613-43819635 AAGAGGAAGGATGAAGAGGTGGG - Intronic
1084065052 11:66699263-66699285 GAGGGGAAGAACTAAGTGGTTGG - Intronic
1085055070 11:73398553-73398575 GAGGGGAAGGAAACAGAGGCTGG + Intergenic
1085790366 11:79492520-79492542 GAGAGGAGGTGAAAAGAGGTAGG - Intergenic
1086154243 11:83648236-83648258 GAGAGGAAGTACAAAGAGGATGG + Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086869053 11:92015142-92015164 GAGGCGGAGTCTACAGAGGTAGG + Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089027672 11:115288851-115288873 GATGGGAAGGTTAAAGAGGAAGG - Intronic
1089036459 11:115398495-115398517 GAGGGGAAGTATATACAATTTGG - Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089912504 11:122116036-122116058 GATGGGAAGAAAAAAGTGGTGGG + Exonic
1090598552 11:128345757-128345779 GATGGGAAATATAAAGACGATGG - Intergenic
1090996224 11:131868313-131868335 GACAGGAAGGAAAAAGAGGTAGG - Intronic
1091867284 12:3851650-3851672 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1091918815 12:4288346-4288368 GAGGGAAAGTACAAGGAGATGGG - Intronic
1092996116 12:13952557-13952579 GAGGGGAAGTACAGATAGGGAGG - Intronic
1093024170 12:14231786-14231808 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1093737482 12:22638126-22638148 GAAGGGAAGGAGAAAGAAGTTGG + Intronic
1094247975 12:28324365-28324387 GAGGGGGACTGTCAAGAGGTGGG + Intronic
1094372679 12:29754866-29754888 GTCAAGAAGTATAAAGAGGTAGG + Intronic
1094661744 12:32475899-32475921 CAGAGGAAATATAAAGAAGTTGG - Intronic
1094871410 12:34601144-34601166 GGGGGGCAGTCTAAAGAGGCAGG + Intergenic
1095209380 12:39475247-39475269 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
1096784708 12:54010292-54010314 TGGGGGAAGTATAAAAAAGTTGG - Intronic
1096838198 12:54364687-54364709 GAGGGGAAGAAAACAGAGTTTGG - Intergenic
1096861168 12:54529413-54529435 GAGAGGAAGGAGAAAGAAGTAGG - Intronic
1097918736 12:65048293-65048315 GAGGGGGAGTGAAGAGAGGTTGG + Intergenic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1099695459 12:86013446-86013468 GAGGGGAAGTATAGAGTGAAAGG - Intronic
1099795480 12:87394473-87394495 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1099965548 12:89441160-89441182 GAGGTGAAGTCTACAGAGGTGGG - Intronic
1100682973 12:96949060-96949082 GTGGGGGAGTATTAAGAGTTTGG - Intronic
1101150907 12:101881535-101881557 GAAGGGAAGTACAAAGAGTAGGG - Intronic
1101314073 12:103613282-103613304 GAGGTGGAGTATACAGAGGTAGG + Intronic
1101524847 12:105519459-105519481 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
1102401476 12:112633357-112633379 GTGTGGCAGTATCAAGAGGTGGG + Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102545545 12:113652417-113652439 CAGGGGAAGTGGAACGAGGTGGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102831229 12:116002232-116002254 GTTGGGAAGTATACAGAGATTGG - Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104510247 12:129370886-129370908 GAGGGGAAATAAAGAGAAGTTGG + Intronic
1105671782 13:22626696-22626718 GGAGAGAAGTACAAAGAGGTAGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106194338 13:27480453-27480475 AAGGGGCAGTATTGAGAGGTGGG + Intergenic
1106423158 13:29600727-29600749 GAGGGGAAGGATGAATAGGTGGG + Intergenic
1106849597 13:33775302-33775324 GAGGGGAAGAAAAAAAAGGAGGG - Intergenic
1107655821 13:42591376-42591398 GAGGGGAAAAATCATGAGGTGGG - Intronic
1107772719 13:43806098-43806120 GAGGTGGAGTATCAAGAGGAAGG - Intergenic
1108553262 13:51567558-51567580 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1109607142 13:64711427-64711449 GAGGGGGGGTGAAAAGAGGTTGG - Intergenic
1109957834 13:69591246-69591268 AAGGTGAAGTATTAAGAGGTAGG - Intergenic
1110381976 13:74862943-74862965 GGGGGAAAGTATAGAGAGATAGG + Intergenic
1113488124 13:110670104-110670126 GAGGTGGAGTCTACAGAGGTGGG - Intronic
1113969625 13:114178941-114178963 GAAGGGCAGAAGAAAGAGGTAGG + Intergenic
1115362322 14:32517740-32517762 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1116198307 14:41757352-41757374 GAGGTGAAGTCTACAGAGGCAGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116927989 14:50660733-50660755 GAGGGGAGGTAAAGAGAGGTAGG - Intronic
1118050904 14:62026562-62026584 AAGTGGTAGTATTAAGAGGTGGG - Intronic
1118054249 14:62062832-62062854 GACGGGAAGTAGAGACAGGTAGG - Intronic
1118449092 14:65881159-65881181 AAGGGGACATAAAAAGAGGTTGG - Intergenic
1118887749 14:69880345-69880367 GTGGGGTACTGTAAAGAGGTGGG + Intronic
1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG + Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120789314 14:88564231-88564253 GAGGGAAAACATAAAGAGATCGG - Intronic
1121148247 14:91605428-91605450 AAGCGAAAGTATCAAGAGGTTGG + Intronic
1121298900 14:92853355-92853377 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1121303449 14:92890065-92890087 GAGGAGCAGTCAAAAGAGGTGGG + Intergenic
1121948895 14:98151578-98151600 GAGGGGATGGGTAAAAAGGTTGG + Intergenic
1121972116 14:98367834-98367856 GAGGGGAGGTTTGAAGAGGGAGG - Intergenic
1122755504 14:103976021-103976043 GGGGGGAAATAGGAAGAGGTTGG - Intronic
1124833881 15:33176612-33176634 GAAAGGAAATATAAAGAGGCTGG - Intronic
1124918227 15:33997660-33997682 GAGGGGCAGTAAAAAGATATTGG - Intronic
1125090586 15:35787169-35787191 CAGGGGAAATAAAAAGAGGTTGG - Intergenic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1127000863 15:54502994-54503016 GAATGGAAGTATAAAAGGGTGGG + Intronic
1127704343 15:61532537-61532559 GATGGGAAGTAAGAACAGGTAGG - Intergenic
1128173553 15:65533288-65533310 GAGGGGAGGGTTAAGGAGGTTGG + Intronic
1129060024 15:72853325-72853347 GAGGGAAAGAATGAAGAGGTGGG - Intergenic
1130450132 15:84042935-84042957 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1130730136 15:86483336-86483358 GAGGGGCAGTTTAAGGTGGTTGG + Intronic
1132139708 15:99382126-99382148 GAGGTGGAGTCTACAGAGGTAGG + Intronic
1132144560 15:99421226-99421248 GAGGTGGAGTCTACAGAGGTCGG + Intergenic
1132347601 15:101117906-101117928 GTGTGGTAGTATTAAGAGGTGGG + Intergenic
1135153909 16:20035773-20035795 GGGGAGAAGTATGAAGAGTTGGG + Intronic
1137616330 16:49849666-49849688 GAGGGGAGGTAAACAGAGGGAGG + Intronic
1138036083 16:53608080-53608102 GAGTGGCAGGAGAAAGAGGTGGG - Intronic
1138592526 16:58009903-58009925 GAGGGGAGGAGTAAAGAGGGCGG - Intronic
1138680158 16:58678371-58678393 GAGGGGCAGGATGAAGAGGAAGG + Exonic
1139155591 16:64437917-64437939 GAGGGGAAGGAGAAAAAGGCCGG + Intergenic
1140222206 16:73052016-73052038 GGGGCCAAGTAAAAAGAGGTGGG + Intronic
1140615342 16:76656265-76656287 GAGGGAAATTATAAAGAAGAAGG - Intergenic
1143454323 17:7056298-7056320 AATGCGAAGTATTAAGAGGTGGG + Intergenic
1143930449 17:10417818-10417840 GAGGGGGAGAATAAAGAGGAAGG - Intronic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1145738356 17:27249724-27249746 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1145916081 17:28574871-28574893 GAGGGGCAGAGTAATGAGGTTGG - Intronic
1148910559 17:50940182-50940204 GAGGGGAGGTAGGAAGAGGCTGG + Intergenic
1149507849 17:57210892-57210914 GATGGGGAGAACAAAGAGGTTGG + Intergenic
1149561535 17:57611212-57611234 AAGGGGAAGTCTTAGGAGGTGGG + Intronic
1151042706 17:70882399-70882421 GACTGAAAGTGTAAAGAGGTAGG + Intergenic
1151539483 17:74757885-74757907 GAGGGGCAGTCTTGAGAGGTGGG + Intronic
1153773841 18:8435811-8435833 GAAGGGAAGAATAAAGAGACGGG - Intergenic
1153941985 18:9986523-9986545 GCGGGGAAATATAAGAAGGTGGG + Intergenic
1154268387 18:12898403-12898425 GAGGGGAACTATAACGATTTTGG + Intronic
1154432310 18:14317663-14317685 GATTGGAAGTAAAAACAGGTGGG + Intergenic
1155121384 18:22823353-22823375 GACTGTAAGTATCAAGAGGTGGG + Intronic
1156963131 18:43057061-43057083 GGGGGGAAGTATAAAAATGTAGG + Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158295664 18:55994377-55994399 GATGGGAAGTATAAAGGGAAAGG - Intergenic
1158323451 18:56289048-56289070 GTGGGGAAGGATAAACAGATGGG + Intergenic
1158410324 18:57199519-57199541 GCGGGGAAGTAGAAGGAGGTAGG - Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1162105163 19:8365887-8365909 GAGTGGATGAATTAAGAGGTTGG + Intronic
1162274382 19:9641235-9641257 GAAGGTAAGTTTAAAGAGGAAGG + Intronic
1162286468 19:9742684-9742706 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1163673343 19:18642235-18642257 GAGTGGAAGGATGAAGAGGAAGG - Intronic
1164265620 19:23613942-23613964 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1164591994 19:29512373-29512395 GAGAGGGAGTATAAGGAGGAAGG + Intergenic
1164954843 19:32373296-32373318 AAGGGATAGTATTAAGAGGTGGG - Intronic
1166409437 19:42546879-42546901 GAAGGGAATGATACAGAGGTTGG + Intronic
925324395 2:3006233-3006255 CATAGGAAGTAAAAAGAGGTCGG + Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
927960212 2:27236565-27236587 GATGGGAAGAAGAAAGAGGGAGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930584393 2:53252412-53252434 GGGTGGGAGTATATAGAGGTGGG + Intergenic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
932218069 2:69979519-69979541 GAGGGGCAGGACACAGAGGTGGG + Intergenic
932507166 2:72246289-72246311 AAGGGGAAATATAAAGTGTTAGG - Intronic
932627570 2:73310365-73310387 GAGGGGAAATAAGAAGATGTTGG - Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933229647 2:79791652-79791674 TAGAGGAAGTAGAAAGAAGTAGG + Intronic
933248730 2:80004585-80004607 GAGAGGAAGAGAAAAGAGGTTGG + Intronic
933290880 2:80436958-80436980 GAGTGATAGTATTAAGAGGTGGG + Intronic
933765783 2:85707853-85707875 GAGGGAAACAAGAAAGAGGTTGG - Intergenic
933982938 2:87568419-87568441 GAGGGAAAGGAGAAAGAGGGAGG - Intergenic
934089816 2:88541384-88541406 GTGTGGCAGTATGAAGAGGTGGG - Intergenic
934493429 2:94778082-94778104 GGCTGGAAGTACAAAGAGGTGGG - Intergenic
934694939 2:96392984-96393006 CAGGGGAAGGATGAAGAGCTGGG - Intergenic
934999679 2:99001014-99001036 GAGGTGAAGTCTACAGAGATAGG - Intronic
935816437 2:106850317-106850339 GCTGGGAAGTAGAAAGAGGCAGG + Intronic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936310903 2:111382376-111382398 GAGGGAAAGGAGAAAGAGGGAGG + Intergenic
937073355 2:119082764-119082786 GCAGGAAAGTAGAAAGAGGTTGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940602115 2:155875493-155875515 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
942329078 2:174803040-174803062 GGGGGGAATTAAAAAAAGGTGGG + Intronic
942859400 2:180591204-180591226 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
942989484 2:182182344-182182366 GAGGGTAAGCAAAAAGAGATTGG - Intronic
943430351 2:187792387-187792409 TAGGGGAAGTTTCAAGAGGAGGG + Intergenic
943472680 2:188314405-188314427 GAGGGGGAGGATAAAGATCTAGG - Intronic
943473798 2:188329564-188329586 GAGAGGTAGTAGAATGAGGTGGG + Intronic
944558443 2:200910891-200910913 GTGTGGAAGTATAAAGACATGGG - Exonic
944810957 2:203327733-203327755 GTGGGGAAGTGCAAAGAGGCAGG + Intergenic
944936111 2:204570275-204570297 GGTGGGAAGTATAAAGAACTTGG + Intronic
945128279 2:206537538-206537560 GAAAGGAAGCAGAAAGAGGTGGG - Intronic
945432518 2:209780794-209780816 GAGGGGAAGTTTACATGGGTAGG - Intronic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946550938 2:220801395-220801417 GAGGGAAGGTAGGAAGAGGTTGG - Intergenic
946555164 2:220848347-220848369 GAGGGGAGGTATTAAAATGTGGG + Intergenic
946970307 2:225083587-225083609 GAGGAGAAGGATGCAGAGGTAGG + Intergenic
1169273950 20:4220889-4220911 GAGGGGAAGTAATAAGGGGTAGG + Exonic
1170518329 20:17155405-17155427 GAGGGGAGTTAAAGAGAGGTTGG - Intergenic
1170539226 20:17371211-17371233 GAAGGGAAGGATGCAGAGGTCGG - Intronic
1170840984 20:19924388-19924410 GAGGTGGGGTATGAAGAGGTGGG - Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173689978 20:44953113-44953135 GAGAGGAAGGATGAAGATGTGGG - Intronic
1174623483 20:51894988-51895010 GAGTGACAGTATTAAGAGGTGGG + Intergenic
1175400596 20:58697987-58698009 GAGGGGAAGGACACAGAGGGAGG - Intronic
1175998485 20:62821732-62821754 GGAGGGAAGTAAAGAGAGGTGGG - Intronic
1176089571 20:63312917-63312939 GAGGGGAAGGCTCACGAGGTGGG + Exonic
1176743709 21:10631620-10631642 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1177456759 21:21349918-21349940 GATGGGAAGTATAGTGAGGTGGG + Intronic
1177597494 21:23264810-23264832 TATGGAAAGTACAAAGAGGTTGG + Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1178176896 21:30112320-30112342 GACAGGATGTGTAAAGAGGTAGG - Intergenic
1179164711 21:38926348-38926370 GAGGGCAAGTAAAGAGAGGGGGG - Intergenic
1180523863 22:16235576-16235598 GAGGTGGAGTCTAAAGAGGCAGG - Intergenic
1182789841 22:32941992-32942014 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1184274552 22:43402782-43402804 GAGTGGAAGTATGTGGAGGTTGG + Intergenic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
950750878 3:15127073-15127095 GAGTGGATGTATAAATGGGTTGG - Intergenic
951495616 3:23321821-23321843 GAATGGGAGTATAAAGAGCTTGG - Intronic
951743808 3:25954347-25954369 GAATGGGAGAATAAAGAGGTTGG + Intergenic
952513973 3:34085312-34085334 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
953041439 3:39258056-39258078 GAGGGGAAGGTTAAAGGGGCTGG + Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954432906 3:50480809-50480831 GAGGGGGAGGGTAAAGAGGAAGG + Intronic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
955424629 3:58775598-58775620 GAAGGGAAGTAGAAAGAGAAGGG + Intronic
955595724 3:60588432-60588454 GAGGGGAAGGAGAAAGAGAGGGG + Intronic
956056841 3:65308160-65308182 GAGGGGAAGTAAGAAGAGAGGGG + Intergenic
957030854 3:75238989-75239011 TAGGGGAGGTATAGAGAGATTGG + Intergenic
957154378 3:76528942-76528964 TAGGCCAAGTAGAAAGAGGTGGG + Intronic
957523519 3:81351212-81351234 GAGGGGAATGATATAGAGGAAGG - Intergenic
957702105 3:83727519-83727541 GAGGGGAAGCATAAGTGGGTTGG - Intergenic
958479752 3:94631135-94631157 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
958755323 3:98244838-98244860 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
959308241 3:104696584-104696606 GAGGTGGGGTCTAAAGAGGTGGG + Intergenic
959413266 3:106051786-106051808 GTTGGGAAGTAAAGAGAGGTTGG - Intergenic
959888676 3:111530239-111530261 GAGGGGATGTATGAACAGGGAGG - Intronic
959966605 3:112362893-112362915 GAGGGGAAAGATAGAGAGGAGGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960936421 3:122906721-122906743 GAGGGGGAGGAAAAAGAGGAGGG + Intergenic
961501066 3:127336439-127336461 GAGGAGAATTGAAAAGAGGTGGG + Intergenic
961958804 3:130832350-130832372 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
962088233 3:132214289-132214311 GAGTGGTGGTATTAAGAGGTAGG + Intronic
962278034 3:134030268-134030290 GAGGGGATGGAGAAAGAGGTTGG + Intronic
962379488 3:134886097-134886119 AAGGTGAAGTGTAAAGAGGCAGG + Intronic
962767787 3:138581382-138581404 AAGAGGAAGTAGAAAGAGATAGG + Intronic
963109068 3:141670440-141670462 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
963315836 3:143757830-143757852 GGGGGGTAGTATGAAGAGGTTGG + Intronic
963384989 3:144581325-144581347 GTGGGGAAGTATAAAAAGGAGGG + Intergenic
963527313 3:146430820-146430842 AAGGGGGAGAATAAAGAGGGAGG - Intronic
963846164 3:150159919-150159941 GGAGGGAAGTATAAAAAGCTGGG - Intergenic
964002092 3:151787207-151787229 TAGGGGAAGGAGAAAGAGATGGG - Intergenic
964214385 3:154263111-154263133 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
964428675 3:156580561-156580583 GAGAGGAAGTAAAAAGGGATCGG - Intergenic
965478550 3:169187560-169187582 GAGGGGAAAAATAAAGAAATGGG + Intronic
965674279 3:171178610-171178632 GAGGGGGAATATCAAGAGATGGG + Intronic
966099644 3:176251140-176251162 GAGGGGAGGGAGAAAGAGGGAGG + Intergenic
967248515 3:187513232-187513254 GAGGGGGAGTCTACAGAGGCAGG - Intergenic
967320959 3:188194616-188194638 GAAGGGAAGTATAATGATGTTGG + Intronic
968289399 3:197526932-197526954 GATGGCAAGTAAAATGAGGTGGG - Intronic
969989167 4:11242714-11242736 GAGGGGGAATGAAAAGAGGTGGG + Intergenic
970095399 4:12458338-12458360 GAGGGGAAGAAAAAAGAGTAGGG - Intergenic
970976273 4:22046524-22046546 AAGGGGAAATATTGAGAGGTGGG + Intergenic
971258606 4:25035570-25035592 GAAGAGAAGTATTAAGAGATTGG + Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973922999 4:55708184-55708206 GAGGTGGAGTCTAAAGAGGCAGG - Intergenic
974243276 4:59280061-59280083 GGGGGGAAGTAAAGAGAGATTGG + Intergenic
974427553 4:61760253-61760275 GAGGTGGAGTCTACAGAGGTAGG + Intronic
974590028 4:63935102-63935124 GAGGCAAGGTAGAAAGAGGTTGG + Intergenic
974944042 4:68504977-68504999 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
975453286 4:74555986-74556008 GAGGACAACTTTAAAGAGGTAGG - Intergenic
975821620 4:78276910-78276932 GAGGTGGAGTCTACAGAGGTAGG + Intronic
976105575 4:81613568-81613590 GAGGGAAAGTAGAAAGAAGTGGG - Intronic
976386451 4:84465070-84465092 AAGGGTAAGTATAAAGAGCCTGG + Intergenic
977330728 4:95634145-95634167 AAGGTGAAGTATGAAGACGTGGG + Intergenic
978782904 4:112575823-112575845 GAGGGGGAGTCTACAGAGGCAGG - Intronic
979279125 4:118844926-118844948 GAGGGGCACTATAAAGAAGAAGG + Intergenic
979599757 4:122574776-122574798 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
979903135 4:126248874-126248896 GAGGAGAGGTATAAAAAGGATGG + Intergenic
980586971 4:134830196-134830218 GAGGTGGAGTCTAAAGAGGCAGG - Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
984836670 4:184028802-184028824 GGGGGGAAGTTAGAAGAGGTGGG + Intergenic
984966873 4:185147057-185147079 TAGGGGAAGTAAAAAGATCTGGG + Exonic
985295354 4:188431951-188431973 TAGGGGAAGTGTAAGGATGTGGG + Intergenic
986618297 5:9643028-9643050 GAGAGGAAGGATAAAGAGGAAGG - Intronic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988473054 5:31558545-31558567 AAGGGAAAGTATAAAGAAGCTGG - Intergenic
989008646 5:36844441-36844463 GAGGTGTAGTAGAAAGGGGTAGG - Intergenic
989056569 5:37371301-37371323 GAAGGGAAGGATAAAGGGGAGGG + Intergenic
989649621 5:43672879-43672901 GAGGTGGAGTCTACAGAGGTAGG + Intronic
990122621 5:52473915-52473937 GAAGGGAAGGAAAAAAAGGTAGG - Intergenic
990527424 5:56641670-56641692 GAGAGGAAGGAGAAACAGGTGGG + Intergenic
990913824 5:60881455-60881477 GAGGTGAAGTCTACAGAGGCCGG + Intronic
991155005 5:63423689-63423711 GAGGGGAAGCATAACTAGCTGGG + Intergenic
991639450 5:68738609-68738631 GTGGGGAAGTGGAAAGGGGTGGG - Intergenic
991924801 5:71694492-71694514 GAGGAGAAGTAGAAAAAGGGAGG - Intergenic
993121520 5:83780175-83780197 GAGGTAAATTATAAAGTGGTGGG + Intergenic
993180046 5:84541219-84541241 GAGGGGATATAAAGAGAGGTTGG - Intergenic
994773781 5:104017641-104017663 TTGGGGAAGTATTAAGAGCTGGG - Intergenic
994856433 5:105126935-105126957 GAGGTGAAGAATAAAGGGCTGGG - Intergenic
994866407 5:105277390-105277412 GAGGGGAAATGAAGAGAGGTTGG + Intergenic
995248519 5:109962874-109962896 GAGGTGAAGATTAGAGAGGTTGG - Intergenic
995329874 5:110934512-110934534 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
995537632 5:113153258-113153280 GAGGGGAGATATAATGAGGAAGG - Intronic
996216400 5:120871738-120871760 GAAGAGAATTATAAAAAGGTAGG - Intergenic
996423721 5:123290438-123290460 GAGGGGAAAAATATAGAGGTGGG + Intergenic
996469974 5:123848800-123848822 GAGGGGGAATAAAAAGAAGTTGG - Intergenic
998028002 5:138837467-138837489 GAGGGGGAGGATCAAGAGGAGGG - Intronic
998468370 5:142363972-142363994 GAGGAAAAGGATAAAGGGGTGGG + Intergenic
998555103 5:143115448-143115470 GAGGAGAAATACAAATAGGTAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
1000122934 5:158215004-158215026 ATGGGGAAGTACAAAGAGTTGGG + Intergenic
1000531158 5:162422088-162422110 GGGGGAAAGTCTAAAGAAGTGGG - Intergenic
1002420091 5:179141439-179141461 GAATGGAAGTGTAAGGAGGTTGG + Intronic
1005178568 6:23076514-23076536 GTGGGGGATTATGAAGAGGTTGG + Intergenic
1005529911 6:26692697-26692719 GTTGTGAAGTTTAAAGAGGTTGG - Intergenic
1005540885 6:26808950-26808972 GTTGTGAAGTTTAAAGAGGTTGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1007995892 6:46307437-46307459 GAGGGGAAGTTAAGAGAGGCAGG + Intronic
1010454803 6:76042717-76042739 GAGAGGAAGGATAAAGGGGGAGG + Intronic
1010484305 6:76391055-76391077 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1010966376 6:82213868-82213890 GAGGGGAAGGAGAAAGAGAAGGG + Intronic
1010993110 6:82502032-82502054 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
1011001646 6:82595557-82595579 GAAGGCAAGTAAAAAGAAGTTGG + Intergenic
1012608632 6:101188667-101188689 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1015091280 6:129362398-129362420 GAGGGGAAGAGGGAAGAGGTTGG - Intronic
1015261239 6:131240502-131240524 GAGGTGAAGTCTATAGAGGCAGG + Intronic
1016274688 6:142335354-142335376 GAAGGGAAGTAGAAAAAGTTAGG + Intronic
1017179595 6:151538612-151538634 GTGGGGTAGTACACAGAGGTAGG + Intronic
1018504477 6:164450053-164450075 GTTGAGAAGTATCAAGAGGTCGG + Intergenic
1019736518 7:2652572-2652594 GTGGGGGAGTTTGAAGAGGTCGG + Intronic
1019766055 7:2851341-2851363 GAGAACAAGTATAAAGAGATGGG + Intergenic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020330340 7:7011399-7011421 GAGGTGGAGTCTAAAGAGGCAGG + Intergenic
1020440795 7:8214624-8214646 GGGTGGAAATACAAAGAGGTGGG - Intronic
1020758685 7:12240294-12240316 GAGGGAAAGTAGAGAGGGGTTGG - Exonic
1021037389 7:15816851-15816873 GAGGCATAGTATAAAGAAGTTGG + Intergenic
1021805161 7:24348226-24348248 GAGCAAAAATATAAAGAGGTGGG - Intergenic
1022237842 7:28479034-28479056 TTGGGAAAGTATAAAGAGGTGGG + Intronic
1022656185 7:32321348-32321370 GAGGAGAAGAATCAAGGGGTTGG + Intergenic
1022971484 7:35521366-35521388 GTGGGGCAGTATTGAGAGGTGGG - Intergenic
1025034196 7:55582790-55582812 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
1026228470 7:68462964-68462986 GAGGGGAAGAACAAAAGGGTAGG - Intergenic
1028046847 7:86130868-86130890 AAGGGGAAGTAAAAAGGGGACGG + Intergenic
1028472245 7:91218362-91218384 GATGGGAAGTGAAAAGAAGTAGG - Intergenic
1029850146 7:103453446-103453468 GAGGTGAAGTCTATAGAGGAAGG + Intergenic
1029965463 7:104735312-104735334 GAGGTGAAGTCTACAGAGGCAGG + Intronic
1030193267 7:106830556-106830578 GAAGGTAAGTTTAAAGAGGAAGG - Intergenic
1030566931 7:111169270-111169292 GAAGGGAAGGAGAAAGAGTTGGG - Intronic
1030970334 7:116047546-116047568 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1033246257 7:139718820-139718842 GAGGGAAAGAATTAAGAGGGGGG - Intronic
1033496111 7:141898043-141898065 GAGGGGTATGATTAAGAGGTTGG - Intergenic
1033784356 7:144712895-144712917 GAGGGGAAAAAAATAGAGGTAGG + Intronic
1034138177 7:148791188-148791210 AAGTGGAAGTAGAAAGAGCTTGG - Intronic
1034546107 7:151790495-151790517 GAGGCCAAGAATAGAGAGGTGGG - Intronic
1036370288 8:8156480-8156502 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1037129886 8:15395037-15395059 GAGGGTAACTATAAGGAGATAGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1038889721 8:31706158-31706180 GAGGGGGAGTAAAAGGAGCTGGG - Intronic
1038922490 8:32100081-32100103 GAGGGGAGGAATAAAGAGGGAGG - Intronic
1039436263 8:37561367-37561389 GAGGGGGAGGAGAAAGAGGGTGG + Intergenic
1040102268 8:43516340-43516362 GAGTGGAAGAAAAAAGGGGTGGG + Intergenic
1041027355 8:53700751-53700773 GAGGTGGAGTCTAAAGAGGCAGG + Intergenic
1041185496 8:55296195-55296217 GAGGGGAAGGAGGGAGAGGTGGG + Intronic
1042425543 8:68643718-68643740 GTGTGGTAGTATAAGGAGGTAGG - Intronic
1042682246 8:71398891-71398913 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
1042889334 8:73589966-73589988 GAAGGGAAGAAGAAAGAGGAGGG + Intronic
1042940166 8:74099386-74099408 GAGGGGCAGCATAAGGTGGTTGG - Intergenic
1044007923 8:86960529-86960551 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1044583291 8:93843700-93843722 TAGGGGTGGTATAAAGTGGTCGG + Intergenic
1045088229 8:98710687-98710709 GAGGTGGAGTCTACAGAGGTAGG - Intronic
1045337962 8:101224966-101224988 GAGGGGAACTGTAGAGAGATTGG + Intergenic
1045403870 8:101845807-101845829 GAGGGTAAATATAGAGAGGGTGG - Intronic
1046363167 8:113187858-113187880 TTGGAGAAGTATAAAGGGGTAGG - Intronic
1046609833 8:116410854-116410876 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1046629362 8:116608076-116608098 GAGGGGAAGAACAAGGAGTTTGG - Intergenic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1047155716 8:122315735-122315757 GGGGAGATGTATAAAGAGTTTGG + Intergenic
1047166349 8:122443466-122443488 GGGTGGCAGTATAATGAGGTGGG - Intergenic
1047733229 8:127743683-127743705 GATGGAATGTATAAAGAGGAAGG + Intergenic
1048753394 8:137704658-137704680 GAGGGGCAGTCAAAAGAAGTGGG + Intergenic
1050044278 9:1527138-1527160 GAGGGGAAATAAGAAGAGGGAGG + Intergenic
1050049929 9:1588983-1589005 GAGGGGGAGTGTACAGAGGCAGG + Intergenic
1050273396 9:3970917-3970939 GAGGGGAAATAAAAAAAGGATGG + Intronic
1050611150 9:7355137-7355159 GAGGGGTAGGAAAAAGAGGCAGG - Intergenic
1051919094 9:22243219-22243241 GATGGGAAGGATAATGAGGAAGG + Intergenic
1052877564 9:33578764-33578786 GGGTGGAAGGAAAAAGAGGTGGG + Intergenic
1053301913 9:36958470-36958492 GGGGGGAAGTGTGAGGAGGTGGG + Intronic
1053498424 9:38565444-38565466 GGGTGGAAGGAAAAAGAGGTGGG - Intronic
1053663640 9:40301955-40301977 GGTTGGAAGTACAAAGAGGTGGG + Intronic
1053914154 9:42932497-42932519 GGTTGGAAGTACAAAGAGGTGGG + Intergenic
1054375764 9:64448188-64448210 GGTTGGAAGTACAAAGAGGTGGG + Intergenic
1054520975 9:66074330-66074352 GGTTGGAAGTACAAAGAGGTGGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056886307 9:90447264-90447286 TTTGGGAAGTGTAAAGAGGTTGG + Intergenic
1057057725 9:91976838-91976860 GTGTGAAAGTATTAAGAGGTGGG + Intergenic
1057486718 9:95490725-95490747 GAGGGGAAATGAAGAGAGGTGGG + Intronic
1057677881 9:97149931-97149953 GGGTGGAAGGAAAAAGAGGTGGG - Intergenic
1057706739 9:97400047-97400069 GAGGGAAAGAAGAAAGAGGTTGG - Intergenic
1057880202 9:98787353-98787375 AAAGGGCAGTGTAAAGAGGTTGG - Intronic
1057931307 9:99195927-99195949 GAAGGGACTTATGAAGAGGTGGG - Intergenic
1058146921 9:101422620-101422642 TAGGGGAAATGAAAAGAGGTTGG + Intronic
1058496458 9:105563698-105563720 GAGGTGAAGTCTACAGAGGCAGG - Intronic
1059033337 9:110725349-110725371 GATAGTAAGTATAAAGAGATTGG + Intronic
1059130155 9:111739442-111739464 GAAGGGAGGTATAAAGAGGCAGG - Intronic
1060949727 9:127594068-127594090 TAGGGGATGTATCAACAGGTAGG + Intergenic
1061231115 9:129316389-129316411 GTGGGGCAGTATCGAGAGGTGGG - Intergenic
1062112130 9:134787961-134787983 GAGAGGATGGATAAAGAGATAGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1185870501 X:3660899-3660921 GAGGGGAAGGAAGAAGAGGTGGG + Intronic
1186017836 X:5218111-5218133 AAAGGGAAGGATAAAGAGGAAGG + Intergenic
1186053717 X:5627013-5627035 GAGGGGAGGGAGAAAGAAGTAGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186103507 X:6181721-6181743 GTGTGGCAGTATTAAGAGGTGGG - Intronic
1187469655 X:19557672-19557694 GAGGGGAAATATCAAGATGCAGG - Intronic
1187506342 X:19881399-19881421 AATGGGAAGTAAAAAGAGGCAGG + Intronic
1187556248 X:20354943-20354965 GAGGGAAATTATCAAAAGGTTGG - Intergenic
1187848486 X:23566253-23566275 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
1188895710 X:35665886-35665908 AAGGGGAGGAAAAAAGAGGTAGG - Intergenic
1189010114 X:37038549-37038571 GAGGGGAAGGATGAAGAGAATGG + Intergenic
1189038470 X:37517181-37517203 GAGGGGAAGGATGAAGAGAATGG - Intronic
1189110507 X:38285781-38285803 GAGGGGAAGTATCAGGAGACAGG - Exonic
1189185844 X:39054047-39054069 GAGGGGCAGCTTAAAGAGGTTGG + Intergenic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189226600 X:39418746-39418768 GAGGGGAAGAAAAGAGAGCTGGG + Intergenic
1189939271 X:46104392-46104414 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1190285766 X:48960408-48960430 GAGAGGAAGGATGGAGAGGTAGG - Intergenic
1190927420 X:54921995-54922017 GAGGGGGCGTGTAAAGGGGTGGG + Intronic
1191017688 X:55827621-55827643 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1191656848 X:63607555-63607577 GAGGTGGAGTCTATAGAGGTAGG - Intergenic
1191675276 X:63786082-63786104 TGGGGGAATCATAAAGAGGTGGG - Intergenic
1191809473 X:65171637-65171659 GAGGTGGAGTCTACAGAGGTAGG + Intergenic
1192033861 X:67543928-67543950 GAGGGGAGGGAAAAGGAGGTGGG + Intergenic
1192368540 X:70495255-70495277 GGGAGGAAGAATACAGAGGTAGG - Intronic
1192764813 X:74129669-74129691 GAAGGTAAGTTTAAAGAGGAAGG + Intergenic
1192871784 X:75191558-75191580 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
1192912218 X:75616932-75616954 GAGGTGGAGTCTACAGAGGTCGG - Intergenic
1193088725 X:77471163-77471185 GAGGTGAAGTCTACAGAGGCAGG - Intergenic
1193367374 X:80651109-80651131 GAGGTGGAGTCTACAGAGGTGGG - Intergenic
1194193217 X:90862011-90862033 GAGTGGTAGTATAAATAAGTAGG - Intergenic
1195001203 X:100645006-100645028 CAAGGGAAGTAGAAAGATGTGGG - Intronic
1195735883 X:108011943-108011965 GAGGTGGAGTCTACAGAGGTAGG - Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196474708 X:116069042-116069064 GAGGTGAAGTCTACAGAGGCAGG + Intergenic
1196762508 X:119212191-119212213 GAGGCCAAGAAAAAAGAGGTAGG + Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1199074462 X:143512769-143512791 GAGGGCAAGTCTGAATAGGTGGG - Intronic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1200539832 Y:4444393-4444415 GAGTGGTAGTATAAATAAGTAGG - Intergenic
1200793543 Y:7320244-7320266 GAGGGGAAGGAAGAAGAGGTGGG - Intergenic
1200832025 Y:7695318-7695340 TTGGGGAAGTAGAAAAAGGTTGG + Intergenic
1201013419 Y:9573389-9573411 GAGGTGGAGTCTAAAGAGGCAGG + Intergenic
1201247251 Y:12016832-12016854 GAGGGGAAGAAAAAAGACATTGG - Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201602603 Y:15747924-15747946 GAGGTGGAGTCTACAGAGGTAGG + Intergenic