ID: 1038570467

View in Genome Browser
Species Human (GRCh38)
Location 8:28657918-28657940
Sequence ATGGGAAGGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1522
Summary {0: 1, 1: 1, 2: 11, 3: 156, 4: 1353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038570467_1038570475 19 Left 1038570467 8:28657918-28657940 CCTTCCTCTTTCTGCCTTCCCAT 0: 1
1: 1
2: 11
3: 156
4: 1353
Right 1038570475 8:28657960-28657982 TGCTTGAGGATTCTGGTAACTGG No data
1038570467_1038570472 5 Left 1038570467 8:28657918-28657940 CCTTCCTCTTTCTGCCTTCCCAT 0: 1
1: 1
2: 11
3: 156
4: 1353
Right 1038570472 8:28657946-28657968 CAATTAAAGCCAGCTGCTTGAGG No data
1038570467_1038570473 12 Left 1038570467 8:28657918-28657940 CCTTCCTCTTTCTGCCTTCCCAT 0: 1
1: 1
2: 11
3: 156
4: 1353
Right 1038570473 8:28657953-28657975 AGCCAGCTGCTTGAGGATTCTGG No data
1038570467_1038570476 24 Left 1038570467 8:28657918-28657940 CCTTCCTCTTTCTGCCTTCCCAT 0: 1
1: 1
2: 11
3: 156
4: 1353
Right 1038570476 8:28657965-28657987 GAGGATTCTGGTAACTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038570467 Original CRISPR ATGGGAAGGCAGAAAGAGGA AGG (reversed) Intronic
900081176 1:858723-858745 GTGGGAAGGAAGGAAGAGGGTGG + Intergenic
900638227 1:3675979-3676001 ATGGGAGGGCAGGAAGGGGGTGG + Intronic
900720303 1:4171741-4171763 AAGGGAAGGCAGCAAGCAGAGGG - Intergenic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
900862969 1:5246119-5246141 AGAGGAAGGAAGGAAGAGGAAGG - Intergenic
900863126 1:5246653-5246675 GAGGGAAGGAAGAAAAAGGAAGG - Intergenic
901053562 1:6437973-6437995 ATGGGCAGGCAACAAGCGGATGG + Intronic
901166049 1:7222415-7222437 AGAGGAAGGGAGAAAGAGGAGGG - Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901300418 1:8196337-8196359 TTGGCTAGGAAGAAAGAGGAAGG + Intergenic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
901809379 1:11758526-11758548 ATGGGAAGGCTGAAGGTAGAAGG + Intergenic
902104931 1:14027010-14027032 ATGGGAAGGTAAAACTAGGATGG + Intergenic
902480715 1:16710171-16710193 ATGGGCAGGCAACAAGTGGATGG - Intergenic
902623546 1:17664190-17664212 AAGGGAAGGGGGAAAGAGAATGG + Intronic
902797965 1:18811651-18811673 AGGAGAAGGGAGAAAGATGAAGG - Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903303336 1:22394332-22394354 AAGGGAAGGGAGAGAAAGGAAGG + Intergenic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903414015 1:23168945-23168967 CTGGGAAGGGAAAAAAAGGACGG - Exonic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903760888 1:25698027-25698049 AAGTGAAGGCAGGAAGAGCAGGG - Intronic
903799465 1:25955736-25955758 GAGGGAAGGAAGAAGGAGGAAGG + Intergenic
904028762 1:27520974-27520996 ATGGGATGGCTGGAAGAGAAGGG + Intergenic
904106764 1:28091134-28091156 ATGGGAAAGTACAAAGAGGATGG - Intergenic
904455481 1:30645471-30645493 GTGGAAAGGGAGAGAGAGGAAGG - Intergenic
904868964 1:33604639-33604661 ATGGGATGCCAGAATGAAGAGGG + Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905282734 1:36859526-36859548 CCGAGAAGGCAGAAAGAAGAAGG - Intronic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
905601524 1:39256248-39256270 AGGGGAAGGCTGACAGAGGTAGG + Intronic
905757006 1:40518951-40518973 ATGCGAAGGCTGAATCAGGAAGG - Intergenic
905857037 1:41321024-41321046 ATGGGAAGGCGGACAGAGGAGGG - Intergenic
906107112 1:43301103-43301125 ATGAGAAGCCAAGAAGAGGATGG - Exonic
906265832 1:44428657-44428679 ATGCGAAGTCGGAAAGAGGGAGG - Intronic
906613195 1:47217665-47217687 ATGGCAAGTCTGAAAGAAGAGGG + Exonic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907390120 1:54152741-54152763 ATGGGAAGCCAGAAAGCAGGAGG - Intronic
907535456 1:55151467-55151489 AAGGGGAGGAAGTAAGAGGAAGG + Intronic
907904687 1:58773558-58773580 AAGTGAAGTCAGAAAGAGGCAGG - Intergenic
907908400 1:58806066-58806088 AAGGGAAGGGAGAAAAAGGGTGG - Intergenic
907965293 1:59323006-59323028 AGAAGAAGGCAGAGAGAGGAGGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908313544 1:62909788-62909810 AAGGGAAGGGGGAAAGAGGAAGG + Intergenic
908418586 1:63937273-63937295 CTGGGATGGCAGTAAAAGGACGG - Intronic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908426128 1:64009268-64009290 AAGGGAAGGGAGAAAGACAAGGG - Intronic
908800894 1:67879634-67879656 AGGGAAAGGGAGAGAGAGGAAGG - Intergenic
908849536 1:68361333-68361355 ATGACAAGGCAGAATGAGGTAGG - Intergenic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910276175 1:85451343-85451365 ATATAAAGGCAGAAAGAAGAGGG + Intronic
910679993 1:89853179-89853201 GTAGGAAGGGAGTAAGAGGAAGG + Intronic
910698155 1:90043834-90043856 ATGGGAAGAAAGAAAGGGGTTGG + Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911786115 1:101950265-101950287 ATGTGAAGAAAGCAAGAGGATGG - Intronic
911974685 1:104477039-104477061 ATGGCAAGTCAGTGAGAGGAGGG + Intergenic
911989070 1:104668870-104668892 ATGGAAGGGAAGAAAGAGAAGGG - Intergenic
912612865 1:111066481-111066503 ATGGGAAGCTTGAAAGGGGATGG - Intergenic
912753597 1:112305868-112305890 CTGGGAAGGCTGAGAGAAGAAGG + Intergenic
912873639 1:113332611-113332633 CTGGTACGGTAGAAAGAGGAAGG + Intergenic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
913219774 1:116650045-116650067 GTGGTAAGGCAGAAAGGAGAGGG - Intronic
913241333 1:116832602-116832624 ATGTAAAGGAAGAAAGGGGAGGG - Intergenic
913272537 1:117108424-117108446 ATGGGTGGGCAGTAAGAGCAGGG + Intergenic
914196449 1:145450459-145450481 ACGGGAAGGCAGACGGAGGCAGG + Intergenic
914756101 1:150562343-150562365 ATGGGCGGGCAGAAAGAGAAAGG - Intergenic
914880247 1:151541088-151541110 ATCGGCAGGCAGATAGAGGGAGG - Intronic
914918626 1:151833065-151833087 ATGAGTAGTGAGAAAGAGGAGGG + Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915589673 1:156863383-156863405 ATGGAAAGGCTCAACGAGGAGGG - Intronic
915691825 1:157697953-157697975 AAGTGAAGGCAGAAACAGCAGGG - Intronic
916104365 1:161420110-161420132 GTGGGAAGGAAGAAAAATGAAGG + Intergenic
916189058 1:162161139-162161161 TGGGGAAGGAAGAATGAGGAGGG - Intronic
916478818 1:165196474-165196496 GAGGCAAGGCAGATAGAGGATGG - Intergenic
917013992 1:170508753-170508775 GTGGGAAGATAGAAAGAGGTTGG - Intergenic
917099532 1:171431447-171431469 ATGGGCAGCTAGAAAGGGGATGG + Intergenic
917439516 1:175054779-175054801 ATGGGAAGGCAGGAGGCAGAGGG + Intergenic
917449858 1:175138462-175138484 ATGGGAGGGGACAAAGAGGGAGG + Intronic
917651251 1:177079601-177079623 ATGGCATGGCAGAAAGAAGCAGG - Intronic
917674023 1:177302286-177302308 AGAGGCTGGCAGAAAGAGGAGGG - Intergenic
917969893 1:180199775-180199797 ATGGGAAGCCAGGAAGTGGGAGG + Exonic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918440243 1:184559550-184559572 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918719051 1:187829344-187829366 AGGGGAAGGAAGAGAGAGGATGG - Intergenic
919061565 1:192640618-192640640 ATAGGAAGGAAGAAAATGGAAGG - Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919207506 1:194436862-194436884 GTGGGAAGGCCGAAAGTGGATGG + Intergenic
919791982 1:201297761-201297783 ATGGGAAGGGAGGAAATGGAGGG - Intronic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
920413139 1:205778164-205778186 ATGGCAATGTAGTAAGAGGAAGG - Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
921129695 1:212209052-212209074 CTGGGAATGGAGACAGAGGAGGG + Intergenic
921320051 1:213930000-213930022 TTGGGAGGGCAGAGAGAGGCAGG - Intergenic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921957612 1:221000477-221000499 AGGGGAAGGAAGAGGGAGGAAGG - Intergenic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922058686 1:222066523-222066545 CTGGGAAGGCAGGAAAAGTAGGG + Intergenic
922244773 1:223785495-223785517 ATGGGAATGAAGAAAGACGTAGG + Intronic
922360444 1:224816903-224816925 ATGGGAAGGCAAGATGTGGAAGG + Intergenic
922360812 1:224819684-224819706 ATGGCCAGGGAGAAAGAGGCAGG - Intergenic
922755349 1:228093554-228093576 ATGGAATGGCAGAACCAGGATGG - Intronic
922983275 1:229846896-229846918 ATAACAGGGCAGAAAGAGGAGGG - Intergenic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
923258529 1:232243716-232243738 ATGGGAATGCAGAAAGAGAGGGG - Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923334885 1:232959518-232959540 ATGGGAATGAAGAAAGGAGAAGG + Intronic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
924095815 1:240549746-240549768 TTGGCAAGGCAGAAAGGGGAAGG + Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924278676 1:242413721-242413743 ATGGAAAGGTAGGAAGAGGCAGG + Intronic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
924571746 1:245243184-245243206 TTGGCAAGGGAGAAACAGGATGG - Intronic
1063147618 10:3310172-3310194 ATAGCAAGGCAGAAAGAGGGAGG + Intergenic
1063451254 10:6151752-6151774 AAAGGAAGTGAGAAAGAGGAAGG + Intronic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1064705644 10:18069916-18069938 ATGGCAAAGCTGAAAGAGCATGG + Intergenic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1064944642 10:20773935-20773957 ATGGGAAGGAAAGAAAAGGAAGG + Intergenic
1065228296 10:23570144-23570166 GGGAGAAGGCAGAAAAAGGAGGG - Intergenic
1065438337 10:25724405-25724427 AGAGGAAGGAAGGAAGAGGAAGG + Intergenic
1065608528 10:27446665-27446687 AAGGGAAGGAAGGAAGGGGAAGG - Intergenic
1065840024 10:29694911-29694933 AAGGAAAGGCAGCTAGAGGAAGG + Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065870551 10:29952688-29952710 ATGGCAAGGCAGGAGCAGGAGGG + Intergenic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1066047198 10:31604044-31604066 ATGGGGAGGCAACAGGAGGAGGG - Intergenic
1066061551 10:31727891-31727913 AAGGGAAGGCAGAAAGGCCATGG + Intergenic
1066084841 10:31966051-31966073 ATGGCAAGGAAGAAGAAGGATGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066276204 10:33871064-33871086 ATGGGAAGGCATATAGAGAAAGG - Intergenic
1066294591 10:34043196-34043218 ATGGGCGGCCAGAAAAAGGATGG - Intergenic
1066305115 10:34133016-34133038 ATGGGAAGCTGGAAAGGGGATGG - Intronic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1067063883 10:43092927-43092949 AGGGGAAGGGAGTAAGAGGACGG - Intronic
1067143967 10:43680157-43680179 AGGGGAAGGCAGAAAAGGCAGGG - Intergenic
1067241013 10:44493588-44493610 AAGAGAAGGAAGAGAGAGGAAGG - Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1067923437 10:50482876-50482898 AATGGAAGGCAGAAAAAGGCAGG + Intronic
1067940676 10:50652661-50652683 AGAGGAAGACAGAAAGAGAAGGG + Intergenic
1067968853 10:50945991-50946013 TTAGGGAGGCAGAAAGAGGATGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068188630 10:53619976-53619998 ATGCCTAGGCAGACAGAGGAGGG - Intergenic
1068263853 10:54621796-54621818 GTGGGCAGGAAGAAAGAGAAGGG + Intronic
1068287459 10:54959118-54959140 ATGAGAAGGCAGGAAGAGAAGGG + Intronic
1068523074 10:58098928-58098950 ATGGGAGGGGAAAAAGAGGAGGG - Intergenic
1068556819 10:58467498-58467520 ATGGGAAGGCAAACACAGGTGGG - Intergenic
1068727939 10:60324140-60324162 ATATGAAAGCAGAAAGAGAAGGG + Intronic
1068805167 10:61187064-61187086 ATTAGAATTCAGAAAGAGGATGG + Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1068890008 10:62139003-62139025 AAGAGAAGGCAGAAAAAGAATGG - Intergenic
1069354943 10:67574349-67574371 ATTGGAAGGAAGAAAGGGTAAGG - Intronic
1069631467 10:69899643-69899665 TTAGGAAGGCAGGAAGAAGAAGG - Intronic
1069801715 10:71085870-71085892 CTGGCAAGGTAGACAGAGGAGGG - Intergenic
1070314101 10:75294699-75294721 CGGGGAAGGAAGAGAGAGGAGGG + Intergenic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070457796 10:76634076-76634098 ATAGGAAGGAACAAATAGGAAGG + Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071104711 10:82080889-82080911 GAGGGAAGGAAGAAAGAAGAGGG - Intronic
1071268964 10:83989751-83989773 AAAGGAGGGAAGAAAGAGGAAGG + Intergenic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071368766 10:84928715-84928737 CTGAGAAGGCAGGAAGGGGAAGG + Intergenic
1071444897 10:85736304-85736326 GAGAGAAGGAAGAAAGAGGAAGG + Intronic
1071822326 10:89291184-89291206 AAAGGAAGGAAGTAAGAGGAAGG - Intronic
1072085657 10:92076876-92076898 AGGGAAAGGAAGGAAGAGGAAGG + Intronic
1072261262 10:93676359-93676381 ATGTGAAGGAAGAAAGATAAAGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072682431 10:97516897-97516919 AGGGGAGGGCAGTAAGAGGTGGG + Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073726052 10:106232369-106232391 AAGGGAAGGGGAAAAGAGGATGG - Intergenic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074138917 10:110653883-110653905 ATTGGAAAGTAGAAAGAGGTGGG - Intronic
1074444869 10:113513414-113513436 GGGGGAAGGAAGAGAGAGGAGGG - Intergenic
1074733372 10:116401275-116401297 ATTGCAAGGAAGAAAGTGGAAGG + Intergenic
1074925736 10:118068540-118068562 GGGGGAAGGCAGAGAAAGGATGG - Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1076052974 10:127349834-127349856 ATAGGAAGACACAAAGAAGAAGG - Intronic
1076081566 10:127586266-127586288 AAGGGAAGGCAGAGAGGTGAAGG + Intergenic
1076195103 10:128512178-128512200 TTGGGAAGGAGGAAAGAGCAGGG + Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076255607 10:129022198-129022220 GTGGGAAGGCAGGGAGAGGTCGG - Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076601971 10:131663162-131663184 ATTAGAAGACAGAGAGAGGAAGG - Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077166469 11:1142017-1142039 ATGGGAGGAGAGAAAGAGGATGG + Intergenic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1078176066 11:8971826-8971848 ATGGGAAGGTATATAGAGTAGGG + Intergenic
1078334011 11:10450191-10450213 AGGTGAAGGCAGAGCGAGGAGGG + Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078451597 11:11444401-11444423 ATGGGAACCCAGACAGAGGTTGG - Intronic
1078613900 11:12847100-12847122 ATGGGCAGGCAGAAAGGGAGGGG - Intronic
1078938884 11:15977970-15977992 ATGGAAAGGCAGGCAGAGAATGG - Intronic
1078978508 11:16505123-16505145 AGAGGAAGGTAGAAAGATGAGGG + Intronic
1079060077 11:17240928-17240950 AGAGGAAGGAAGGAAGAGGAGGG - Intronic
1079253841 11:18809389-18809411 ATCAGAAGAAAGAAAGAGGAAGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081051849 11:38351077-38351099 AGAAGAAGGCAGAAAGATGAGGG - Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081438312 11:43053046-43053068 ATGGGCAGTCAGAAAGAGATCGG + Intergenic
1081574413 11:44310260-44310282 AGGGGAAGAGAGAGAGAGGAGGG - Intergenic
1081670620 11:44940231-44940253 ATGGGGAGGCTGGAAGAGGAAGG - Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081932490 11:46881701-46881723 ACTGGATGGCAGTAAGAGGAAGG - Exonic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082090757 11:48087838-48087860 AGGGGAAGGCAGGGAGAAGAAGG - Intronic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1083444518 11:62698793-62698815 ATGGGAAGGCAGAGAGCCAAGGG - Intronic
1083682594 11:64358329-64358351 AGGGAAAGGCAGGAAGAAGACGG + Intergenic
1083920168 11:65778180-65778202 CGGGAAAGGCAGAAAGAGGTCGG + Exonic
1084470403 11:69356138-69356160 ATGGGATGGGAGAGAAAGGAAGG + Intronic
1084528901 11:69715180-69715202 AAGGGAGGAAAGAAAGAGGAAGG + Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084920963 11:72469290-72469312 ATGGGATGGGAGAGAGAGGTGGG - Intergenic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085458407 11:76678691-76678713 ATGGGAAGGAAGAGAGAGAGGGG - Intergenic
1085623733 11:78056420-78056442 AGGGAATGACAGAAAGAGGAAGG - Intronic
1085651105 11:78269361-78269383 ATGAGAAGACAGAAAGAGTAAGG + Intronic
1085667182 11:78424816-78424838 ATAGGAAGGATGTAAGAGGAAGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085947009 11:81284459-81284481 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1086223323 11:84476828-84476850 GTGGGAAGACACAAAGAGGCTGG - Intronic
1086561807 11:88177040-88177062 AGAGGAAGGCAGAAAGACAATGG - Intergenic
1086696979 11:89858904-89858926 AGGGGAAGCCAGAGAGAAGAGGG + Intergenic
1086709179 11:89985583-89985605 AGGGGAAGCCAGAGAGAAGAGGG - Intergenic
1086794046 11:91078293-91078315 AGAGGAAGAAAGAAAGAGGAAGG - Intergenic
1086855112 11:91856470-91856492 ATGAGAAAGCAGACAAAGGAGGG + Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1087140015 11:94756013-94756035 ACGGGAAACCAGAAAGGGGATGG + Intronic
1087177088 11:95106042-95106064 ATGGGAAGGCGGGAAGAGAGAGG - Intronic
1087422100 11:97942544-97942566 ATGTGAAGACAGAAACAGAATGG + Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1087741206 11:101889229-101889251 AAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1087877003 11:103370239-103370261 AGGGGAAGGAAGAAAGGAGAAGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088540443 11:110908271-110908293 ATTAGAAGGGAGCAAGAGGAAGG + Intergenic
1088767187 11:112994070-112994092 ATGGCAAAGCAGAAAGAAAAAGG - Intronic
1088894156 11:114065112-114065134 ATGAGAAGGGAGACAGAGCAAGG - Intronic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089400989 11:118164597-118164619 CTGGGAAGGGAGAAACAGCAGGG - Exonic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089629101 11:119772733-119772755 ATGGGGTGGCAGCAGGAGGAGGG + Intergenic
1089631962 11:119789464-119789486 AGGGGCAGGTAGGAAGAGGAGGG + Intergenic
1089691490 11:120189402-120189424 ATGGGAGGGCAGGAAGTGGATGG + Intergenic
1089696753 11:120220632-120220654 CTGGGAGGGCAGTCAGAGGAGGG + Intronic
1089717058 11:120370787-120370809 ATGGGAAGGAAGAAACAGGAAGG - Intronic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090167955 11:124571217-124571239 AGAGGAAGGAAGGAAGAGGAAGG - Intergenic
1090259598 11:125309191-125309213 AAAGGAAGGAAGAGAGAGGAAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090439825 11:126716203-126716225 AGGCGGAGGAAGAAAGAGGAAGG + Intronic
1090554123 11:127855597-127855619 ATGGGGAGCTAGAAAGAGGATGG + Intergenic
1090799857 11:130163630-130163652 TTGGGAAGGCAGAAAGCAGCAGG + Intronic
1091132074 11:133154752-133154774 AGGAGAAGGAAAAAAGAGGAGGG + Intronic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091393895 12:142047-142069 AGTGGAAGCCAGAAAGAGCACGG - Intronic
1091416840 12:295247-295269 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1091445478 12:542350-542372 ATGGGCAGGCAGGGAGAGGAGGG - Intronic
1091593300 12:1858201-1858223 AAAGGAGGCCAGAAAGAGGAGGG - Intronic
1091602495 12:1926349-1926371 GAGGGAAGGCAGAAAGAAGGAGG - Intergenic
1091675621 12:2486907-2486929 GTGGGAAGGCTCAAAAAGGAAGG - Intronic
1091689769 12:2588040-2588062 ATGGGAAGGCAGGAAGAGCTGGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092065327 12:5585499-5585521 GTGGGACGGGAGAAAGAGCAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093024519 12:14233861-14233883 ATGTGAAAGCAAAAAGAGGTTGG - Intergenic
1093070231 12:14700867-14700889 ATGGGAAGGAAGAAAGATCAGGG + Intergenic
1093293931 12:17364548-17364570 AAGAGAAGGCTGAAAAAGGAAGG + Intergenic
1093934764 12:24988783-24988805 GTGTGAAGGCAGACAGAGAAGGG - Intergenic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094234346 12:28146406-28146428 AGAAGAAGGAAGAAAGAGGAAGG + Intronic
1095631179 12:44379129-44379151 AAAGAAAGGAAGAAAGAGGAGGG + Intronic
1095660025 12:44721994-44722016 AAGGAATGGCACAAAGAGGAGGG + Intronic
1095721475 12:45406063-45406085 AGAGGAAGGAAGGAAGAGGAGGG - Intronic
1095880305 12:47129110-47129132 AAAGGAAGGCAGAAAGCAGAAGG - Intronic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096320635 12:50609554-50609576 TTGGGAAGGGAGAAAGAGAAGGG + Intronic
1096555717 12:52402480-52402502 ATGGGTGGCAAGAAAGAGGAAGG - Intronic
1096732472 12:53625827-53625849 GTGGAATGGGAGAAAGAGGAGGG - Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1097502138 12:60417966-60417988 ATGGGAAGGTGAAGAGAGGATGG + Intergenic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098237098 12:68427888-68427910 ATGGCATAGCAGAAAGAGGGAGG - Intergenic
1098386453 12:69924294-69924316 ATGGAAAGGAAGAAACAAGATGG - Intronic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098775542 12:74609625-74609647 ATGGTAAGGTAGAATTAGGATGG + Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099248780 12:80226520-80226542 ATGGGAAGGAAAACTGAGGAAGG - Intronic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1099509635 12:83517994-83518016 ATGGGAAATCGGAAAGGGGATGG - Intergenic
1099609426 12:84848640-84848662 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099959192 12:89380439-89380461 ATGGGAAGGAGGGAAGAGGGAGG - Intergenic
1100256292 12:92886525-92886547 ATGGGAGGGGAGGGAGAGGAGGG + Intronic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1100742874 12:97614683-97614705 AAGAGAAGGAAGAAAGAAGAAGG - Intergenic
1100791896 12:98139434-98139456 AAGGCAAGGGAGAAAGAGGTAGG - Intergenic
1100836394 12:98570978-98571000 ATTGGACGGCAGGAGGAGGATGG + Intergenic
1100978504 12:100146035-100146057 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1101673217 12:106896415-106896437 AGGGGAAGGGAGGAAGAAGAGGG + Intergenic
1101673241 12:106896472-106896494 AGGGGAGGGGAGGAAGAGGAGGG + Intergenic
1101673249 12:106896491-106896513 AGGGGAGGGGAGGAAGAGGAGGG + Intergenic
1101673258 12:106896515-106896537 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101673267 12:106896539-106896561 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101673276 12:106896563-106896585 AGGGGAGGGAAGGAAGAGGAGGG + Intergenic
1101814084 12:108131736-108131758 ATGAGAAAGCAGAGAGAGGGCGG - Exonic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101877839 12:108607173-108607195 AGGGGGAGAGAGAAAGAGGAGGG - Intergenic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103058624 12:117841265-117841287 GGGGGAAGGCAGAAAGGGCAAGG - Intronic
1103162430 12:118740536-118740558 ATGGGAAGGAAGAAAGGAGGAGG - Intergenic
1104650023 12:130524775-130524797 AGCAGAAAGCAGAAAGAGGAAGG + Intronic
1104742503 12:131188754-131188776 CTGGGCAGGCAGAAAGGGGTGGG + Intergenic
1104754193 12:131258621-131258643 ATGGGGAGTCGGAAAGCGGAAGG + Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1105402137 13:20105215-20105237 ATGGGAAGGAGGGAAGAGGCTGG + Intergenic
1105610592 13:21966033-21966055 ATAGGAAGGCAAAAACATGAAGG - Intergenic
1105679963 13:22715979-22716001 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1105840985 13:24253504-24253526 ATGGCAAGGCAGGGAAAGGAAGG + Intronic
1105941025 13:25148351-25148373 AAGGGAAGCCAGAAAGTGGGAGG - Intergenic
1105956730 13:25290251-25290273 ATAGGAAAGAAGAAAGATGAGGG - Intergenic
1105972286 13:25440309-25440331 AGGGGAAGGAAGAAAGAGGAAGG - Intronic
1106262535 13:28079917-28079939 AAAGGAAGGAAGAGAGAGGAGGG + Intronic
1106812758 13:33376405-33376427 ATGGGAAGGCAGCAGGTTGAAGG + Intergenic
1106841147 13:33685997-33686019 ATGGGTCAGCAGAAAGAGGGTGG + Intergenic
1107146254 13:37063516-37063538 ATGAGAATGCAGAAAGAAGGTGG - Intergenic
1107359483 13:39603236-39603258 AGGGGACTGGAGAAAGAGGAGGG - Intronic
1107404941 13:40103347-40103369 ATGGGAGGGGAAAAAGAGGCTGG + Intergenic
1107556349 13:41519543-41519565 ATGCAAAGGCAGAACGCGGAAGG - Intergenic
1107791983 13:44011796-44011818 ATGGTAAGAGAGAAAGAGAAGGG + Intergenic
1107946302 13:45420008-45420030 AGGGGAAAGGAGAAAGAGGGAGG + Intergenic
1108104850 13:46997833-46997855 ATGAGGAGCTAGAAAGAGGACGG + Intergenic
1108597789 13:51964372-51964394 CTGGGAAGGGAGTAAGAGGCAGG + Intronic
1108671199 13:52690807-52690829 AATGGAATGGAGAAAGAGGATGG + Intronic
1108735878 13:53282868-53282890 ATGGGAGGGCAAAGAGAGGTGGG - Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109147862 13:58804357-58804379 ATGGGCAGTCAGAAAGTAGATGG + Intergenic
1109300723 13:60587355-60587377 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
1109792522 13:67268378-67268400 TGGAGAAGGGAGAAAGAGGAAGG + Intergenic
1109833231 13:67821776-67821798 AAGGGAAGGCAGATACTGGAAGG - Intergenic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1109971725 13:69779344-69779366 AAGGAAAGGAAAAAAGAGGAGGG - Intronic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1111741147 13:92207179-92207201 ATGGGAAAGGAAAGAGAGGAGGG - Intronic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112040889 13:95546919-95546941 ATGATAAGGCAGAGAGAGTAAGG - Intronic
1112530541 13:100198107-100198129 AAGGTAAGGAAGAAAGAGGGAGG + Intronic
1112653433 13:101423019-101423041 ATGGAAAGGGAGAAAGAAGGAGG + Intergenic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113067561 13:106387652-106387674 ATGGGAATGCAGAAAGCAGGGGG + Intergenic
1113337669 13:109392682-109392704 AAGGGAAGGAAGGAAGAGAAGGG + Intergenic
1113337673 13:109392700-109392722 AAGGGAAGGAAGGAAGAGAAGGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114479395 14:23022927-23022949 AGGGGAAGGAAGAAAGAGGTGGG - Intronic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1114816793 14:25968505-25968527 GTAGGAAGGCACAAAGAGGAAGG + Intergenic
1114823137 14:26045772-26045794 AGGGAAAGGCATAAAGAGAAGGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115565055 14:34618066-34618088 ATGGGATGGGGCAAAGAGGAAGG + Intronic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1116217905 14:42044081-42044103 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1116217912 14:42044100-42044122 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1116360491 14:43989734-43989756 ATTGGTAGACAAAAAGAGGAAGG + Intergenic
1117062823 14:51980594-51980616 TTAGGCAGGGAGAAAGAGGAAGG + Intergenic
1118362894 14:65070745-65070767 AGGGGAAGGCTGAAAAACGATGG + Intronic
1118514882 14:66516415-66516437 AGGGCAGGGCAGGAAGAGGAAGG - Intronic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118859176 14:69648887-69648909 AAAGGATGGCAGAGAGAGGAGGG - Intronic
1118979099 14:70701695-70701717 AGGGGAAAGGAGGAAGAGGAGGG + Intergenic
1119000062 14:70873572-70873594 ATGGGGAGCAAGAAAAAGGATGG - Intergenic
1119109356 14:71957239-71957261 ATGAGAAGGCATAAGCAGGAGGG + Intronic
1119143939 14:72293479-72293501 GTGGGAAAGCGGAAAGGGGAGGG - Intronic
1119726163 14:76922939-76922961 ATAGGAGGGAAGAAGGAGGAGGG - Intergenic
1119731876 14:76956447-76956469 AGGGGAGGGGAGCAAGAGGAGGG - Intergenic
1119800212 14:77437709-77437731 ATGGATAGGCAGGAAGGGGAGGG - Intronic
1119854019 14:77885985-77886007 GAGGGAAGGAAGAAAGAAGAAGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120353886 14:83402743-83402765 GGAGGAAGGGAGAAAGAGGAGGG + Intergenic
1120560618 14:85987921-85987943 CTGGCAAGGCTGAAAGAAGACGG - Intergenic
1120852581 14:89184810-89184832 ATAGGATGGCAGAAGGATGACGG - Intronic
1121034468 14:90688930-90688952 AGGGGAAGCCAGACAGAGGAGGG - Intronic
1121066277 14:90969085-90969107 ATGGAAAGGCAGGTAGAGAATGG + Intronic
1121098272 14:91233063-91233085 AGGGGAAGGGAGACTGAGGAAGG + Exonic
1121277323 14:92677240-92677262 GTGGGAAGGAGGAAAGGGGAAGG - Intronic
1121338440 14:93091069-93091091 AAGGAAAGGCAGGAAGAGGAAGG + Intronic
1121593338 14:95137414-95137436 AGGGGAAGGGAATAAGAGGAAGG + Intronic
1121609386 14:95265766-95265788 TGAAGAAGGCAGAAAGAGGAAGG + Intronic
1121867506 14:97376803-97376825 ATGGCAAGAGAGAAAGGGGAAGG - Intergenic
1122068586 14:99190599-99190621 AAGGGAAGGAGGGAAGAGGAAGG + Intronic
1122248236 14:100419300-100419322 AGGAGAAGGAAGAAAGAGGTAGG - Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122616553 14:103021960-103021982 ATGGGAAGGCTGACAGAGGCTGG + Intronic
1122767400 14:104081802-104081824 ATGGGAAGTGAGAGAGAAGAGGG + Intergenic
1123083163 14:105705582-105705604 ATGGGTAGGCGGATGGAGGATGG - Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123432251 15:20228639-20228661 TTGAGAAGGCTGAAAGGGGAGGG + Intergenic
1123453522 15:20392012-20392034 AACAGAAGGCAGAAAAAGGAAGG - Intergenic
1124168292 15:27349088-27349110 ATAGGAAATAAGAAAGAGGAAGG + Intronic
1124520455 15:30403956-30403978 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124538202 15:30562263-30562285 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1124760451 15:32445322-32445344 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124778185 15:32603740-32603762 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1124849828 15:33325696-33325718 GGGGGAAGGCAGAGAGGGGAAGG - Intronic
1124992269 15:34687120-34687142 ACAGGAAGGAAGAAAGAGGGTGG - Intergenic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125396196 15:39250760-39250782 ATGGGATGGGAGAAAGGGGCAGG + Exonic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1126297693 15:47159435-47159457 ATTGAAAGGCAGAAAGAAAAAGG + Intergenic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126778454 15:52119084-52119106 ATGGGAAGGGAGGAGGAGGGAGG + Exonic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1127262980 15:57339213-57339235 AGGGGAAGGGAGAAAGGGGAAGG + Intergenic
1127656058 15:61057150-61057172 AGGCGAAGGGAGAGAGAGGAAGG + Intronic
1128133122 15:65243907-65243929 AGGGGAAGGCAGCATGTGGAAGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128522872 15:68387003-68387025 AGGGGAAGGAAGAACGAGAAGGG + Intronic
1128646352 15:69381343-69381365 AAGGGAGGGAAGTAAGAGGAAGG - Intronic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129359259 15:75014213-75014235 ATGGCATGGTAGGAAGAGGATGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129905268 15:79182807-79182829 AAGGGAAGAAAGAAAGAGAAAGG - Intergenic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130264241 15:82384812-82384834 TAGGGAAGGAAGAAAGTGGAGGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130474500 15:84252058-84252080 TAGGGAAGGAAGAAAGTGGAGGG + Intergenic
1130481915 15:84366106-84366128 TAGGGAAGGAAGAAAGTGGAGGG + Intergenic
1130508120 15:84565953-84565975 TAGGGAAGGAAGAAAGTGGAGGG - Intergenic
1130520774 15:84659004-84659026 ATGGGAATGCAGAATGATGGAGG + Intergenic
1130550300 15:84886371-84886393 ATGGGAAGGAAGGAGGGGGAGGG + Intronic
1130691149 15:86082490-86082512 AAGGGAAGGAAGAAAGAGATTGG + Intergenic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131348784 15:91677207-91677229 ATGGGAAGGGGGAAACAGGTGGG - Intergenic
1131671270 15:94621955-94621977 GAGGCAAGGCAGAGAGAGGAGGG + Intergenic
1131676069 15:94671985-94672007 GTGGGAGGGAAGAGAGAGGAGGG + Intergenic
1131687677 15:94788157-94788179 GAGGGAAGGAAGAAAGAGGAAGG - Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1134019472 16:10911464-10911486 ATGGAAAGAAAGAAAGAGAAAGG - Intronic
1134596288 16:15498623-15498645 AGAGAAAGGAAGAAAGAGGAAGG + Intronic
1134892113 16:17850489-17850511 ATGGCAAGGAAGAAAGGGGTTGG - Intergenic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135168761 16:20164680-20164702 AAAGGATGGAAGAAAGAGGAGGG - Intergenic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135755157 16:25091281-25091303 ACGGGAAGGAATAAAAAGGAGGG + Intergenic
1136031194 16:27504301-27504323 AGGGGATGGCAGAGGGAGGAAGG + Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1136647757 16:31636768-31636790 AATGGAAGGAAGAAAGAGGGAGG + Intergenic
1136852386 16:33622503-33622525 TTGAGAAGGCTGAAAGGGGAGGG - Intergenic
1137430614 16:48415343-48415365 ACTGGAAGGCAGATAGAGGATGG + Intronic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137580101 16:49628339-49628361 ATGGGTGGGTAGATAGAGGATGG - Intronic
1137779633 16:51087104-51087126 AAGGGCAGGCAGACAGAGAAAGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138029332 16:53547399-53547421 ATGGTAAGGCAGAACATGGAGGG - Intergenic
1138293864 16:55870337-55870359 AGAGGAAGGGAGAAGGAGGAAGG + Intronic
1138303000 16:55948237-55948259 ATGGGCAGGCCGAGAAAGGAGGG + Intronic
1138458807 16:57135961-57135983 AGGGGAAGGGAGAAGGAGGGAGG + Intronic
1138499564 16:57431164-57431186 TGGGGAAGGGAAAAAGAGGAAGG - Exonic
1138551393 16:57750765-57750787 ATGAGAAGGCTGGCAGAGGAAGG - Intronic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1138772986 16:59687212-59687234 AGAAGAAGGCAGAAAGATGAAGG - Intergenic
1138874125 16:60928587-60928609 ATGGGAAGGCATAGCAAGGAAGG - Intergenic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1139940868 16:70604523-70604545 ATGTGTTGGCAGACAGAGGATGG - Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1140885285 16:79237494-79237516 ATGGGAAGTGAGAAAGAAGTTGG - Intergenic
1141019763 16:80484355-80484377 AAGGGAAGGAAGAAAGAAGGAGG + Intergenic
1141546801 16:84775837-84775859 AAGGGAAGGCAGAAAGGAAAGGG - Intronic
1141852721 16:86658468-86658490 GTGGGCAGGTAGAAAGATGAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141899308 16:86980104-86980126 ATGGGTAGGTAGAAAGAAAAAGG + Intergenic
1141927401 16:87178520-87178542 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1141927409 16:87178553-87178575 AGAGGGAGGCAGAGAGAGGAGGG - Intronic
1142112161 16:88338728-88338750 ATGGGCAGACACACAGAGGAAGG + Intergenic
1142431541 16:90031202-90031224 AAGGCAAGGAAGAAAGAGGGAGG - Intronic
1203113984 16_KI270728v1_random:1470971-1470993 TTGAGAAGGCTGAAAGGGGAGGG - Intergenic
1203142496 16_KI270728v1_random:1777482-1777504 AAGAGGAGGCAGAAAGAGAAGGG - Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142928344 17:3260422-3260444 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
1143131661 17:4682214-4682236 AAGGCAAGGCAGAAAAAGGAAGG + Intronic
1143295636 17:5869878-5869900 AGGTCAAGGCAGGAAGAGGAAGG - Intronic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143669315 17:8385492-8385514 GTGGGAAGACAGGAAGACGATGG - Intergenic
1143795881 17:9336411-9336433 AGGGGAAGGAAGGAAGGGGAAGG - Intronic
1144041363 17:11413997-11414019 AAGGGAAGGAAGGAAGAGAAAGG - Intronic
1144150168 17:12435560-12435582 AGAGGAAGGAAGAGAGAGGAGGG - Intergenic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144300862 17:13922207-13922229 ATGGAAAGCCAGAAGGGGGATGG - Intergenic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144560967 17:16320137-16320159 AAGGGAAGGGAGAGAGAGGAAGG + Intronic
1144871011 17:18370982-18371004 AGGGGAAGGAAGGAAAAGGAAGG + Intergenic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145963089 17:28898644-28898666 ATGGGAGGCCAGCAAGAGGCTGG - Exonic
1146111440 17:30093663-30093685 ATTGGAAAGCAGAAAGTGGTGGG - Intronic
1146289632 17:31598250-31598272 ATGGGAGGGAAGAAGGAGGTGGG + Intergenic
1146328582 17:31908480-31908502 ATTGGAAGGCAGAATGAGAAGGG - Intergenic
1146404216 17:32523242-32523264 ATGGGAAGGCAGGTGGGGGAGGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147308308 17:39578657-39578679 GTGGGAAGTCGGAGAGAGGAAGG + Intergenic
1147399963 17:40174780-40174802 CTGGGTGGGCAGAAAGAAGAGGG + Intergenic
1147906343 17:43825573-43825595 ATGGGGTGGCAGCAGGAGGAGGG - Intronic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1148614674 17:48991234-48991256 AGGGGCAGGGAGGAAGAGGAAGG + Intergenic
1148638699 17:49168901-49168923 GTGGGAAGGCTGAAAGAGTGAGG + Intronic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1148892656 17:50819379-50819401 CTTGGAAGGTAGAAAGAGGCAGG + Intergenic
1149516653 17:57286047-57286069 AGGGAAAGACAGAAAGAGGCTGG - Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1150269062 17:63850670-63850692 AGGGGTAGGCAGTGAGAGGAGGG - Intergenic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150772043 17:68050445-68050467 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151183340 17:72345533-72345555 CCAGGAAGGCAGAAAGAAGAGGG + Intergenic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1151606782 17:75142600-75142622 AGGGGAAGGGGGAGAGAGGAGGG + Intronic
1152010127 17:77707780-77707802 ATGGGAGGGGAGGAAGAGGGTGG + Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152372086 17:79894997-79895019 AATGGAAGGAAGAAAGAGGGAGG - Intergenic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1152811912 17:82386322-82386344 AGGGGAAGGCGGAGGGAGGACGG - Intergenic
1152811966 17:82386513-82386535 AGGGGAAGGCGGAGGGAGGATGG - Intergenic
1153998904 18:10466622-10466644 AGGGGAGGGCAGAATGAGGGAGG + Intronic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155349237 18:24890271-24890293 AAGGGAAGGAAGACAGAGGCAGG + Intergenic
1155371281 18:25103741-25103763 ATGGGAAGAGAGAAGGAGTAAGG + Intronic
1155446666 18:25920187-25920209 AAAGGAAGGCAGAAAGAGAGGGG + Intergenic
1155513422 18:26600114-26600136 TGGGGAAGGGAAAAAGAGGAAGG + Intronic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1156040147 18:32811269-32811291 ATGGAATTGCAGAAAGAGCAGGG - Intergenic
1156042385 18:32837047-32837069 AAGGGAAGGAAGAAAGAACAGGG - Intergenic
1156157816 18:34324327-34324349 CTGGGAAGGCAGAAAAATGTGGG - Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157329551 18:46693342-46693364 TTGAGAAGGGAGAAAGAGAAGGG - Intronic
1157343786 18:46804929-46804951 AGGGGAAGTCTGACAGAGGAAGG + Intergenic
1157549576 18:48572123-48572145 GGAGGAAGGAAGAAAGAGGAAGG - Intronic
1157679540 18:49593694-49593716 ATGGAAAGCCAGAAAAGGGAAGG + Exonic
1157859228 18:51125759-51125781 ATGGGGAGCTAGAAAGAGAATGG + Intergenic
1157898220 18:51488622-51488644 AAAGGAAGGGAGAAAAAGGAAGG + Intergenic
1158057902 18:53303937-53303959 ATGGGAAGCTAGAAAGGGGGTGG + Intronic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158402414 18:57133071-57133093 ATGGGATGTCAGAAAAAGAAAGG + Intergenic
1158556056 18:58475579-58475601 AAGGAAAGGAAGAAAGAGAAAGG + Intergenic
1158744545 18:60184295-60184317 ATTGGAATCCTGAAAGAGGAGGG - Intergenic
1158758519 18:60355879-60355901 AAGGAAAGGAAGAAAAAGGAAGG - Intergenic
1158819475 18:61142587-61142609 ATGTCATGGTAGAAAGAGGATGG + Intergenic
1158820773 18:61156382-61156404 GTGGGAATGGAGAAAGAAGAGGG - Intergenic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1160135315 18:76266410-76266432 AAAGGAAGGAAGGAAGAGGAAGG + Intergenic
1160929991 19:1566123-1566145 ATGGGGAGGCAGTAACAGGATGG + Intronic
1161258889 19:3324701-3324723 AAGGGAGGGCAGGGAGAGGATGG - Intergenic
1161416770 19:4151691-4151713 AGGGGAAGGCAGGGAGGGGACGG - Intergenic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161918716 19:7250258-7250280 ATGGGAAGGAGGAGAGGGGAAGG + Intronic
1162104710 19:8363444-8363466 AAGGAAAGAGAGAAAGAGGAAGG - Intronic
1162274025 19:9638977-9638999 ATGTGAAAGCAAAAAGAGGTCGG + Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163176474 19:15567088-15567110 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1163212957 19:15854945-15854967 ATGGGCAGGCAGACAGAGGCAGG + Intergenic
1163213101 19:15856408-15856430 ATGGGAAGACAGACAGAGGCAGG - Intergenic
1164581831 19:29439397-29439419 AGGGGAGGGGAGAGAGAGGAAGG + Intergenic
1164716440 19:30394032-30394054 ATGGGCAGGCAGAGACAGTAGGG + Intronic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1164970211 19:32525423-32525445 ATGTGCAGGCAGACAGAGTAAGG - Intergenic
1165028474 19:32980018-32980040 TTGAGAAGGCTGAAAGGGGAGGG + Exonic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166142892 19:40814691-40814713 AGGGGAGGGAAGAAAGAGGCTGG - Intronic
1166184666 19:41132121-41132143 AGGGGAGGGAAGAAAGAGGCTGG + Intergenic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166278633 19:41774411-41774433 ATGAGAAGGAAGTAGGAGGAGGG + Intergenic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166397935 19:42456156-42456178 ATGAGAAGGAAGCAGGAGGAGGG - Intergenic
1166413825 19:42577251-42577273 ATGGGAAGGAAGTAGGAGAAGGG - Intergenic
1166685365 19:44793358-44793380 TGGGGAAGACAGACAGAGGAAGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167231240 19:48285140-48285162 AGGGGAAGAAAGCAAGAGGAAGG - Intronic
1167554794 19:50187916-50187938 ATGGGAATGAAGGGAGAGGAAGG + Intergenic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167725662 19:51211288-51211310 ATGGGATGGGAGAAAGTGCAGGG - Intergenic
1167727329 19:51225298-51225320 ATGGGATGGAAGAAAGTGCAGGG - Exonic
1168261889 19:55199959-55199981 AAGGGAAGGAAGGAAGGGGAAGG + Intronic
1168344648 19:55644251-55644273 CTGGGAGGGCACAAAGAGGAAGG + Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1202714752 1_KI270714v1_random:36076-36098 ATGGGCAGGCAACAAGTGGATGG - Intergenic
925042922 2:747669-747691 ATGGGAAGGCATATCGGGGACGG + Intergenic
925064600 2:920561-920583 GTAGGAAGGAAGAAAAAGGAGGG - Intergenic
925199248 2:1952903-1952925 AAGGGAAGGAAGGGAGAGGAAGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925286165 2:2717026-2717048 AAGGCAAGGGAGAAAGAAGAGGG + Intergenic
925645014 2:6027040-6027062 ACAGAAAGGCAGAAAGAGAAAGG - Intergenic
925653849 2:6123585-6123607 AGGGAAAGGAAGAAAGATGAGGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925755516 2:7128312-7128334 GGGGGAAGGGAGAAAGGGGAGGG - Intergenic
925847117 2:8044222-8044244 AGAGGAAGGGAGAAGGAGGAAGG - Intergenic
925871162 2:8271907-8271929 ATGGGAAGACATTGAGAGGATGG + Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
927106395 2:19831046-19831068 ATGTGATGGCAGTGAGAGGATGG + Intergenic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927278038 2:21278488-21278510 ATAGAAAGGCAGAAAGCAGAAGG - Intergenic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
927747814 2:25638208-25638230 ATGGGATGGCAGGAGGGGGAGGG + Intronic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
927929800 2:27036794-27036816 ATGGGAGGGCAGCAAGGGGAAGG + Intronic
927937049 2:27082052-27082074 AGGGGAAGGCAGAAGGCAGAGGG - Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928347903 2:30517693-30517715 AAGGGAAGGGAGAAAGAGAGGGG + Intronic
928370602 2:30737450-30737472 AGGGGTACGCAGGAAGAGGATGG + Intronic
928494026 2:31813456-31813478 ATGGGGAGCTAGAAAGTGGATGG + Intergenic
928782680 2:34844079-34844101 CTAGGAAGTCAAAAAGAGGAGGG + Intergenic
929085403 2:38162760-38162782 ATGGCAAGGCAGTAAAAGGTTGG - Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929464953 2:42136002-42136024 ATGGGAAGCCATACAGAGGAAGG + Intergenic
929828520 2:45329153-45329175 AGGGAAAGGGAGAAAGAAGAGGG + Intergenic
930184351 2:48397019-48397041 AAGTGAAGGCAGAAAGTGGGTGG - Intergenic
930252073 2:49045537-49045559 AAGGGAAGGCAGACAGAGGTAGG + Intronic
930358502 2:50348350-50348372 ATGGGAAGAGAGGAAGAGAAGGG + Intronic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
931385669 2:61795557-61795579 GAAGGAAGGAAGAAAGAGGAAGG + Intergenic
931827298 2:66015030-66015052 ATGGGGAGGCAGGAAGAGAGAGG + Intergenic
931845696 2:66201615-66201637 AGGTGAAGGCAGAAAAAGGAAGG - Intergenic
931877533 2:66529967-66529989 AAGGGCAGGCAGACAGTGGAGGG + Intronic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931902590 2:66806285-66806307 ACGGTAAGGCAGAAAAAGTAAGG - Intergenic
932087888 2:68777874-68777896 TAGGGAAGGCTGAAAGTGGAGGG - Intronic
932781268 2:74560111-74560133 AGGGGAAGTAAGGAAGAGGAGGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933152265 2:78929972-78929994 ACTGGAAGGGGGAAAGAGGAAGG + Intergenic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933250715 2:80025381-80025403 ATAGGAAGGAACATAGAGGAAGG + Intronic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934056212 2:88253395-88253417 ACTGGAAGGGAGAGAGAGGAAGG - Intergenic
934089166 2:88536185-88536207 AAGGGAAGGGAGGAAAAGGAAGG + Intergenic
934119306 2:88824927-88824949 ATGGGAAGAGATAAGGAGGATGG + Intergenic
934156102 2:89202680-89202702 AGGGGAAGCCAGGAAGAGCATGG + Intergenic
934211214 2:89980083-89980105 AGGGGAAGCCAGGAAGAGCATGG - Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935662135 2:105475950-105475972 GTGGGAAGGCAGAAAGTGATTGG - Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936162772 2:110097450-110097472 ATGGGAAGAGATAAGGAGGATGG + Intronic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936451373 2:112636217-112636239 ATGGGTAGGAAGAAAAAGGAAGG + Intergenic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
936622780 2:114117909-114117931 AGAGGAAGGCAGAGAAAGGAGGG - Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
937126257 2:119476717-119476739 CTGGGAAGGCTGAAAAGGGACGG + Intronic
937432203 2:121848455-121848477 ATGGGAAGGGAGGAGGAGAAAGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937509853 2:122583104-122583126 AGGGGAAGGAAGGAAGAGGAAGG + Intergenic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
937843859 2:126555674-126555696 TAGAGAAGGAAGAAAGAGGAAGG + Intergenic
937914827 2:127093825-127093847 TTGGGAAGGAAGGAAGGGGAGGG - Intronic
937942947 2:127302400-127302422 ATGGGAAGGAAGAAGGGGAAAGG - Exonic
938066769 2:128285701-128285723 ATGGGAAGGGAGACAGTGTATGG - Intronic
938707566 2:133945583-133945605 ATGGGAAGGGAGGAAAAGAAGGG + Intergenic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938860423 2:135362432-135362454 AGAGGAAGGCAGAAAGGAGATGG + Intronic
938912676 2:135899600-135899622 AGGGGAAGGTAAAAAAAGGAGGG - Intergenic
938941111 2:136170433-136170455 AGGGGAAGGCAGAAAGAATGGGG + Intergenic
939038281 2:137158766-137158788 AGGGTAAGGCAGAAAGTAGATGG + Intronic
939236270 2:139497884-139497906 ATGAGAAGACACAGAGAGGAAGG - Intergenic
939933782 2:148263349-148263371 ATTGGGAGGCAGAGAGAGGGAGG + Intronic
939959508 2:148553962-148553984 AAGGCAAGGAAGAAAGAGGGAGG + Intergenic
940354522 2:152724476-152724498 ATAGCAAGGCAGAAAAAGAATGG + Intronic
940393578 2:153161914-153161936 GCGGGAAGGCAGAAAGAGAAGGG + Intergenic
940465875 2:154025952-154025974 ATGGGGAGGGAGAGAGAGAAGGG + Intronic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
940770688 2:157836606-157836628 ATGGGAAGGGAGAACAAGGGTGG - Intronic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
941179468 2:162240813-162240835 ATGGCAAGGCAGGAAAGGGAAGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941548049 2:166878533-166878555 AGGACAAGGCAGAGAGAGGATGG + Intergenic
941850706 2:170177307-170177329 AGGGGAAGTGAGAAACAGGAGGG - Intergenic
941872936 2:170404665-170404687 ATAGGAAAGAAGAGAGAGGAAGG - Intronic
942289449 2:174454729-174454751 AAGGGAAGGAAGGAAAAGGAAGG + Intronic
942365620 2:175223187-175223209 AAGGAAAGAGAGAAAGAGGAAGG - Intergenic
942495827 2:176539030-176539052 GTGGGAAGGTAGACAGAGAAAGG - Intergenic
942572380 2:177327331-177327353 ATGGGAAGTCAGAGAGAGATGGG + Intronic
942935258 2:181548289-181548311 AAGGGAAGGGAAAAAGAGAACGG + Intronic
943003406 2:182358942-182358964 AAGGGAAGGAAGAAAGGGAATGG - Intronic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
944230668 2:197388947-197388969 ATGGTACGGCTGGAAGAGGAGGG - Intergenic
944258864 2:197654477-197654499 ATGGGAAGGCTTAAATAAGATGG + Intronic
944849693 2:203705797-203705819 ATGGAAAGAAAGAAAGAGGGAGG - Intergenic
944851272 2:203721931-203721953 GAGGGAAGGGAGAGAGAGGAAGG - Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946285226 2:218697647-218697669 ACGGGGAGGGAGAAAGAAGAAGG + Intronic
946322368 2:218961340-218961362 ATGGAAAGGCAGGGAGAGGGAGG - Exonic
946409399 2:219508768-219508790 CTGGGAAGGGAGAAACAAGAGGG + Intergenic
946498188 2:220217396-220217418 ATGGGAAGTAAGCAAGAGGGAGG - Intergenic
946538590 2:220658633-220658655 AGGAGAAGGGAGAGAGAGGATGG + Intergenic
946793421 2:223324259-223324281 GTGGGAAGGCAGTCACAGGAAGG - Intergenic
946873141 2:224102802-224102824 ATGGAAAGGAAATAAGAGGAAGG - Intergenic
947415274 2:229888943-229888965 AAGGGAAGGCAGAGAGACAAAGG + Intronic
947745477 2:232505078-232505100 AAGGGAAGGCAGAACCATGATGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947914611 2:233823224-233823246 ATATGAGGGCAGAAAGAGGAGGG + Intronic
947972925 2:234339030-234339052 ATTGGAAAGCAGAAAGCCGATGG - Intergenic
948013096 2:234665556-234665578 AAAGGAAGGAAGAAAGAGAAAGG - Intergenic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948091959 2:235302248-235302270 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
948164466 2:235850715-235850737 ATGGGATGGCATAAAGACGAAGG - Intronic
948564222 2:238873363-238873385 CTGAGAAGGAAGCAAGAGGATGG + Intronic
948621550 2:239238410-239238432 ATGGGAAGGGGTCAAGAGGAGGG + Intronic
948650021 2:239436771-239436793 ACAGGAAGGTAGAAAGAGGGTGG - Intergenic
948710386 2:239821622-239821644 TTGGGGAGGCAGAAAGCGGTGGG - Intergenic
949047319 2:241877897-241877919 GGGGGAAGGGGGAAAGAGGAAGG - Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170311116 20:14993044-14993066 AAGAGAAGGGAGAAAGAGGGAGG - Intronic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170440962 20:16378312-16378334 GAGGGAAGGAAGAAAGGGGAGGG + Intronic
1170459676 20:16565603-16565625 AGGGTAAAGCAGAAAGAGAAAGG - Intronic
1170462261 20:16588269-16588291 GTGGGAAGGCAGGAACAGAATGG + Intergenic
1170929730 20:20758162-20758184 ATGGGAAAGCAGAAAGGGACAGG + Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171442460 20:25176382-25176404 GTGTGAAGCCAGGAAGAGGAGGG + Intergenic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171990058 20:31689228-31689250 AAGGAAAGGAAGAAAGGGGAAGG + Intronic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172399133 20:34634018-34634040 AGGGGTGGGAAGAAAGAGGAAGG + Intronic
1172500298 20:35421470-35421492 AGAGGAAGCCAGAAAGAAGAAGG + Intergenic
1172617292 20:36297842-36297864 AGGGGGAGGCCGGAAGAGGATGG - Intergenic
1172633685 20:36394996-36395018 ACGGGGAGGCTAAAAGAGGAGGG - Intronic
1172786164 20:37470158-37470180 AGGGGAAGGGAGCAAGAGGGTGG - Intergenic
1172820019 20:37724323-37724345 TTGGGAAGGAAGAAATAAGAAGG + Intronic
1172897713 20:38312224-38312246 AGAGGGAGGCAGAAAGAGAATGG - Intronic
1173066067 20:39713275-39713297 ATGGCAAGGCAGAAAGAGGCAGG + Intergenic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173421848 20:42908139-42908161 CCGGGAAGGCAGCAAGAGAACGG + Intronic
1173593070 20:44240484-44240506 AAGGGAGGGCAGAAAGAGATGGG + Intergenic
1173767750 20:45629642-45629664 AGGGGCAAGCAAAAAGAGGAAGG + Exonic
1173997152 20:47347026-47347048 ATGGGGAGGGAGGAAGAGGCTGG - Intronic
1174178403 20:48659150-48659172 AGGGGAGGGGAGAAAGGGGAAGG + Intronic
1174359331 20:50018040-50018062 AAGGGAAGGAAGAGAGAGGAAGG - Intergenic
1174532221 20:51223159-51223181 AGGAGAAGAAAGAAAGAGGAGGG + Intergenic
1174712238 20:52719223-52719245 ATGGGAACTCACACAGAGGAAGG - Intergenic
1174714968 20:52747991-52748013 ACGGGAGGGGAGAAAGCGGAGGG + Intergenic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174832715 20:53827767-53827789 ATGGGGAGGAAGAAAGAAGGAGG - Intergenic
1175305703 20:57974167-57974189 ATGGGAAGGCAGAAGCTGGTTGG - Intergenic
1175379794 20:58554881-58554903 AAGGGGAGGCAGAAAGAGCTGGG + Intergenic
1175574384 20:60049894-60049916 GTGGGAGGGCAGAGAAAGGAAGG - Intergenic
1175817830 20:61892891-61892913 ATGGAAAGGTAGAAAGAGGGAGG + Intronic
1176606641 21:8839508-8839530 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177118835 21:17117535-17117557 ATTGGAAGACAGACAGTGGATGG + Intergenic
1177237614 21:18413212-18413234 AAAGGAAGGAAGGAAGAGGAAGG - Intronic
1177304921 21:19302333-19302355 AAAGGAAGGAAGAAAGAGGAAGG - Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1178958514 21:37043952-37043974 TGGGGAAGGCAGAGAGAGGCAGG - Intergenic
1179053191 21:37906818-37906840 AAGAGAGGGCAGAAAGAGGACGG - Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179351978 21:40620480-40620502 AAGGGAAGGGAGAGAGAGGGAGG + Intronic
1179538596 21:42068598-42068620 AGGTGCAGGCAGAAAGAGGCAGG - Intronic
1179594289 21:42431553-42431575 ATGGGAAAACAGCAAGGGGATGG + Intronic
1179939931 21:44630666-44630688 AGGGGAAGGCAGGAAGTGAAGGG + Intronic
1180234610 21:46450266-46450288 ATTAGGAGGCAGAGAGAGGATGG - Intergenic
1180286142 22:10746487-10746509 AGGGGGAGGCAGAAAAAGGCTGG - Intergenic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1180593163 22:16957557-16957579 ATGGAATGGAAGAGAGAGGAAGG + Intergenic
1180821066 22:18828086-18828108 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
1181191912 22:21147959-21147981 GTGGTAAGGCAGAAAGGAGAGGG + Intergenic
1181207285 22:21262551-21262573 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181958539 22:26605882-26605904 GTGGCAGGGCAGAGAGAGGAAGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182465564 22:30514141-30514163 TTCGGAAGGCTGAAAGAGAAGGG - Intergenic
1182651007 22:31851307-31851329 TTGGGAAGGCAGGAAGAGTGTGG + Intronic
1182675048 22:32032518-32032540 ATGGGAAGCCAGAAACAGGTTGG - Intergenic
1182922530 22:34093218-34093240 ATGGGAACGCAGGGAGAAGATGG + Intergenic
1182951594 22:34381306-34381328 ATGGGGATGAAGAAAGAGGTAGG + Intergenic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1183121365 22:35732534-35732556 AAAAGAAGGCAGAAAGAGGCTGG + Intergenic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183627824 22:39015414-39015436 ACGGGGAGAGAGAAAGAGGAGGG - Intronic
1183660832 22:39220312-39220334 AAAGGGAGGAAGAAAGAGGATGG + Intergenic
1183819253 22:40331758-40331780 AGGAGAGGGCAGAAAGGGGAAGG + Exonic
1184355935 22:43979634-43979656 AGGGGAAGGCAGGGAGTGGAAGG - Intronic
1184412279 22:44332059-44332081 AGAGGAAGGGAGAGAGAGGAGGG - Intergenic
1184544103 22:45154085-45154107 ATGGGAAGACAGCAAGAGAATGG - Intergenic
1184666691 22:45992985-45993007 ATGGGAAGGCAGAAGGTGTGTGG - Intergenic
1184768812 22:46586419-46586441 AGGGGAGGGCAGACAGAGGAGGG - Intronic
1184864192 22:47193233-47193255 GTGGCAAGGCAGAAAGGGGGCGG + Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1185353044 22:50348124-50348146 ATGGTAAGGGAGAGAGAGGCAGG + Intronic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
1203219634 22_KI270731v1_random:32865-32887 GTGGTAAGGCAGAAAGGAGAGGG + Intergenic
1203271192 22_KI270734v1_random:53962-53984 GTGGTAAGGCAGAAAGGAGAGGG - Intergenic
949295315 3:2514894-2514916 AAGGGAAGGAAGAAAAAGGGAGG - Intronic
949614623 3:5739634-5739656 AAGGGAAGGGAGAGAGGGGAGGG - Intergenic
949614646 3:5739687-5739709 AGGGGAAGGGAGACAGGGGAGGG - Intergenic
949614657 3:5739711-5739733 AGGGGAAGGGAGAGAGGGGAGGG - Intergenic
949647181 3:6109381-6109403 AGAGGGAGGGAGAAAGAGGAAGG - Intergenic
949706071 3:6818302-6818324 AAAGGAAGCAAGAAAGAGGAGGG + Intronic
950204440 3:11067920-11067942 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950360871 3:12448568-12448590 AAGGGAAGGAAGGAAGAAGAAGG + Intergenic
950360915 3:12448760-12448782 AAGGGAAGGAAGGAAGAAGAAGG + Intergenic
950706261 3:14784371-14784393 TAGGGAAGGGAGAAAGAGGCAGG - Intergenic
950765527 3:15270257-15270279 ATGGCAAGTCAGAACCAGGAAGG + Intronic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
950858180 3:16125016-16125038 AGGGGGAGGCAGAAATATGATGG + Intergenic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951662508 3:25085494-25085516 ATGGGAAGGAAGAGAAAGGAGGG - Intergenic
951930045 3:27955522-27955544 AGAGGAAGGAAGGAAGAGGAAGG - Intergenic
951930077 3:27955653-27955675 AGAGGAAGGAAGGAAGAGGAAGG - Intergenic
951941137 3:28079998-28080020 CTGGCTAGGCAGGAAGAGGAAGG - Intergenic
952384827 3:32832778-32832800 CTAGGAAGGGAGGAAGAGGAGGG - Intronic
952393074 3:32897525-32897547 ATGTGAAAGCCAAAAGAGGAGGG - Exonic
952582284 3:34848614-34848636 GTGGGAAGGCAGACAGGGTAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953005869 3:38978812-38978834 AGGGCAAGGCAGAGAGCGGAGGG - Intergenic
953236855 3:41114432-41114454 TTTGGAAGGCAGAGACAGGAAGG + Intergenic
953415320 3:42712291-42712313 ATGGGAGGTCAGACAGAGGCAGG + Intronic
953455353 3:43036304-43036326 TTGGCAAGGCAGAGAGAGGCAGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954462179 3:50633636-50633658 ATGGCAAGGCTGGAGGAGGAAGG - Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
954848151 3:53577794-53577816 AAGGGAAGGAAAAAAGAGGCTGG - Intronic
955006031 3:54969777-54969799 CTGTGAAGGCAAAAAGTGGAGGG - Intronic
955210533 3:56936277-56936299 AAGTGAAGGCAGAGAGAGAAGGG + Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955345112 3:58155190-58155212 ATGGGTGGGCAGACAGAGGCTGG - Intronic
955639156 3:61063504-61063526 ATGGGAAGGATGAAAGAGAAGGG + Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956340760 3:68221286-68221308 ATGGGAAGGAGAAAAGAGAAGGG - Intronic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957288044 3:78242045-78242067 ATAGGAAGGGAAGAAGAGGATGG - Intergenic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
957984964 3:87562462-87562484 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958074500 3:88658239-88658261 ATGGGGAGCCAGAAGGCGGATGG + Intergenic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
958258326 3:91350993-91351015 ATTGGGAGGCAGAGAAAGGAGGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
959651750 3:108757157-108757179 ATGAGAAGGAGGCAAGAGGACGG + Exonic
959693586 3:109225111-109225133 ATGCCTAGGCAGAAAGGGGAGGG - Intergenic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960606698 3:119513260-119513282 AGGGGAAGGCATAAACTGGAGGG + Intronic
960972748 3:123151216-123151238 AAGGAAAGGCAGAAAGAGATGGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961165282 3:124759482-124759504 GGGGGAAGGTAGGAAGAGGATGG + Intergenic
961347727 3:126274900-126274922 ATGGGAGGCAAGAAAGAAGAGGG - Intergenic
961444174 3:126971320-126971342 CTGGGAATGCACACAGAGGAAGG + Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961532447 3:127547742-127547764 AGGGGAAGGCAGCGAGAGGAGGG - Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
962214253 3:133506779-133506801 GAGGGAAGGCAAGAAGAGGAAGG + Intergenic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962449349 3:135499106-135499128 ATATAAGGGCAGAAAGAGGATGG + Intergenic
962641226 3:137388836-137388858 AAAAGAAGACAGAAAGAGGAAGG - Intergenic
963219841 3:142797009-142797031 AGGGGAAGAAAAAAAGAGGAAGG - Intronic
963399908 3:144785423-144785445 AGGGGAAGGAACATAGAGGATGG - Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
963796292 3:149634069-149634091 ACAGGAATGGAGAAAGAGGAAGG + Intronic
963933751 3:151031557-151031579 GTGGTAAGTCAGAAAGAAGAAGG + Intergenic
964040219 3:152252304-152252326 ATGGGAAGCCAGAAAGAGAGAGG - Intronic
964349188 3:155786112-155786134 ATGGGAAAGGAGAAAGGGAAGGG + Intronic
964389965 3:156186620-156186642 ATGAGAAGGCAGAAGCAGGTAGG - Intronic
964428284 3:156576329-156576351 ATGGGAAGGAAGAGGGAGGGAGG + Intergenic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
964995236 3:162870138-162870160 ATGGGAAGCCAAAAAAAGCAGGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
965489018 3:169314046-169314068 ATGAGAAGTCAGAAATAAGATGG - Intronic
965535010 3:169814206-169814228 ATGGGGAGCCAGAAAGGGAATGG + Intergenic
965843045 3:172929594-172929616 ATGAGAAGGCAGGAGGAGAAAGG - Intronic
965947288 3:174258851-174258873 AAGGGAAGGGAGGAAAAGGAAGG + Intronic
966019033 3:175183994-175184016 GTGTGAAGGCAGAAAGCTGAAGG - Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966458040 3:180140551-180140573 ATGGAAAGACAGAAAGAGTCTGG - Intergenic
966580274 3:181553755-181553777 AAGGAAAGGCAGAGAGAGAAGGG + Intergenic
967337459 3:188360465-188360487 ATGAGAAGAAAGAGAGAGGAGGG - Intronic
967537702 3:190625968-190625990 ATGGGAGGGTAGATAGAGTATGG + Intronic
967986925 3:195102024-195102046 AAAGGAAGAGAGAAAGAGGAAGG + Intronic
967991081 3:195131236-195131258 ATGGGGAGACGGAAAGAGGGTGG - Intronic
968096473 3:195934131-195934153 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
968118570 3:196108401-196108423 AGGGGAAGGGAGATAGTGGAGGG + Intergenic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968530140 4:1087039-1087061 ATGGGATGGCGGTGAGAGGATGG + Intronic
968534710 4:1116498-1116520 GGGGGAAGGGAGAAAAAGGAAGG - Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969246436 4:5936263-5936285 TTAGAAAGACAGAAAGAGGATGG + Intronic
969438772 4:7204814-7204836 TTGGGAAGTCAGAAATAGGCTGG + Intronic
969481351 4:7448685-7448707 AGAGGAAGGCAGAGAGAGGAAGG - Intronic
969501008 4:7552946-7552968 AGAGGAAGGCAGAACTAGGAAGG + Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
971222432 4:24720702-24720724 ATGGGAAGGAGGATAGAGCAAGG + Intergenic
971630771 4:28990346-28990368 ATGGGAAGACAGAGAGAGACTGG - Intergenic
971796823 4:31238931-31238953 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
972108573 4:35525650-35525672 TGGGGAGGCCAGAAAGAGGATGG + Intergenic
972138136 4:35918819-35918841 ATGGGAGGGCATAATGAGTATGG + Intergenic
972281447 4:37605892-37605914 AAAGAAAGGAAGAAAGAGGAAGG + Intronic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972415769 4:38839065-38839087 ATAGAAAGAGAGAAAGAGGAAGG + Intronic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
973184324 4:47306550-47306572 AGGGGAAGGAAAAAAGAGGATGG - Intronic
973331047 4:48910398-48910420 AGGGGAGGGGAGAGAGAGGAAGG - Intergenic
973371471 4:49251649-49251671 ATGGGAAGCTGGAAAGGGGATGG - Intergenic
973389537 4:49543662-49543684 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
973555464 4:52077279-52077301 ACGGGAAGAAACAAAGAGGAAGG - Intronic
973739008 4:53901636-53901658 ATGGGAGGGGAGAAAGGGAAGGG + Intronic
973932111 4:55803542-55803564 ATGGGAAGGAAGAAAGACTTTGG + Intergenic
974091573 4:57316644-57316666 CTGAGGAGGCAGAAAGAGGGGGG + Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974453729 4:62099409-62099431 ATGGGAAGGGAAGAAGTGGATGG - Intergenic
974685996 4:65230591-65230613 ATTGGAATGCAGGAAGAGAAAGG + Intergenic
975143928 4:70946815-70946837 AGGGGAAGGAAAAAAAAGGAGGG + Intronic
975628933 4:76380234-76380256 ATCAGAAGACAGAAAGACGAGGG + Intronic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
976313728 4:83637452-83637474 ATGTGAAGGCAGACAGTGCAGGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
977125967 4:93168254-93168276 AGGGGAAGAAAGAAAGAGAAAGG + Intronic
977261433 4:94801464-94801486 ATGGTAGGGAAGATAGAGGAGGG - Intronic
977370363 4:96126669-96126691 ATGGGAAAGGAGAAAGAAAAGGG + Intergenic
977919223 4:102625198-102625220 AGAGAAAGGGAGAAAGAGGAAGG - Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978286692 4:107086321-107086343 ATGGAAAGAGAGAGAGAGGAAGG + Intronic
978560676 4:110030423-110030445 AAGGGCAGGCTGAAAGAAGAAGG - Intergenic
978752621 4:112268806-112268828 ATGTGAAGGAAGCATGAGGAGGG + Exonic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980250064 4:130303513-130303535 ATGGGAGGCTAGAGAGAGGAGGG + Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
980640290 4:135568360-135568382 ATGTGATGGCACAAAGAGGTGGG - Intergenic
980727606 4:136785597-136785619 AAAGGAAGGAAGAAAAAGGAAGG - Intergenic
981013581 4:139951127-139951149 ATGGGGAGAAAGAAAGAGGGAGG - Intronic
981086473 4:140689472-140689494 AAGGGAAGGGAAAAAGGGGAAGG - Intronic
981165058 4:141548075-141548097 GGGGGAAGGTAGAAAGAGAATGG - Intergenic
981301606 4:143192889-143192911 ATGGAAAGGCAGAAATGGAAAGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982134036 4:152256981-152257003 TTGTGAAGGAAGAAAGAGCAAGG - Intergenic
982144256 4:152365564-152365586 ATGGCAAGTAAAAAAGAGGAAGG + Intronic
982154994 4:152510518-152510540 AAGGGAGGAGAGAAAGAGGAGGG + Intronic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
982441813 4:155444297-155444319 ATAGGTAGGCAGAATGAGAATGG - Intergenic
982538814 4:156641363-156641385 ATGGGAAGGAAGGAAGGGGAAGG + Intronic
982736642 4:159013550-159013572 AGGTGAAGACAGAGAGAGGAAGG + Intronic
982797858 4:159666770-159666792 ATCTGAAGGCAGAAAAAAGAAGG - Intergenic
983049073 4:163022830-163022852 ATGGGAATGGTGAAAGAGAAGGG + Intergenic
983511219 4:168611244-168611266 ATTAGAGGGAAGAAAGAGGAAGG - Intronic
984153125 4:176159423-176159445 ATGTGAAGGGAGAAAGGGGATGG - Intronic
984297331 4:177868819-177868841 ATGTGAAGGCAGAGAGACAATGG + Intronic
984566497 4:181336943-181336965 AAGGGAAGGGAGAGAGAGAAAGG + Intergenic
984573963 4:181425948-181425970 ATGGGGAGCCAGGAAGACGAAGG + Intergenic
984703736 4:182833870-182833892 AGGGGAGGGGAGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984760074 4:183356342-183356364 AAGGGAAGGAAGAAAGAAAAAGG - Intergenic
984911456 4:184676968-184676990 AAGTGAAGGGGGAAAGAGGAAGG - Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985229545 4:187799668-187799690 AGGGGAAGGAAGAGCGAGGAGGG + Intergenic
985277688 4:188254476-188254498 ATGGGATGACAGAAAGATTAGGG - Intergenic
985321873 4:188721675-188721697 AGGGGAAGGAAGAAGGAGAAAGG + Intergenic
985425795 4:189828860-189828882 ATGGTAAGGGAGAGAGAGGCAGG - Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985833848 5:2256596-2256618 AGGCGAAGGCAGAGAGAGGGCGG + Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986200697 5:5575672-5575694 ATAGAAAGTCAGAAAGAGGTGGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986658445 5:10038120-10038142 ATGGGAAGGGAGTGAGAGGAAGG - Intergenic
986694206 5:10337841-10337863 ATGGGCAGAGAGAAAGAGAAGGG + Intergenic
986803252 5:11283367-11283389 ATGGGAGGAAAAAAAGAGGAGGG + Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987363163 5:17124900-17124922 AAAGGAAGGAAGGAAGAGGAAGG - Intronic
987689149 5:21244623-21244645 AGGGGAAGACAGGAAGATGAGGG + Intergenic
988446141 5:31287996-31288018 ATGGCAAGCCACAAAGTGGAAGG - Intronic
989009767 5:36856704-36856726 ATGGGACTGCAGAAAAAGCATGG - Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990140319 5:52695598-52695620 GTGGGTTGGCAAAAAGAGGAAGG - Intergenic
990152452 5:52834689-52834711 AGGGGAAGGAAGGAAGGGGAAGG + Intronic
990375709 5:55168385-55168407 AAGGGATGGTAAAAAGAGGAGGG - Intronic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990597931 5:57329925-57329947 ATGGGAAGGAGGCAGGAGGATGG - Intergenic
990742923 5:58930626-58930648 ATGGGAGTAGAGAAAGAGGACGG - Intergenic
990855387 5:60261055-60261077 ATGGGAAGACATAAAAATGAAGG + Intronic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992125638 5:73637268-73637290 AGGGGAAGGGAGAGAGGGGATGG - Intronic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992481978 5:77160193-77160215 TTGGGAAGGCAGAGAGAAAAAGG - Intergenic
992598951 5:78377042-78377064 AAGGGAAGCAAAAAAGAGGAGGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993004464 5:82415594-82415616 GTGGGAAGGAAGTAAGAGGCAGG + Intergenic
993159187 5:84266697-84266719 ATAGGAATGTAGAGAGAGGAAGG - Intronic
993812315 5:92496989-92497011 GTTGGAAGGTAGAAAGATGATGG - Intergenic
994397857 5:99240961-99240983 TAGGGAAGGGAGAATGAGGATGG + Intergenic
994579701 5:101625264-101625286 TTAGGAAGGCAGAGACAGGAGGG + Intergenic
994728227 5:103461631-103461653 TGGGGAAGGAAGAAAGAGAAAGG - Intergenic
994762820 5:103878220-103878242 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
995011092 5:107258020-107258042 ATGGCACGGCAGCAAGAAGAGGG - Intergenic
995154820 5:108898541-108898563 AAGGGAAGGGAGGAAGGGGAGGG - Intronic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995487194 5:112651248-112651270 AGGGGAAGAGAGAAAGAGGACGG - Intergenic
995516664 5:112961079-112961101 ACAGGAAGGGACAAAGAGGAAGG + Intergenic
995969408 5:117949745-117949767 ATGAGAAGAAAGGAAGAGGAAGG + Intergenic
996213883 5:120844025-120844047 ATGATAAGGCAGAAAGAGTTCGG - Intergenic
996236638 5:121138896-121138918 ATGGGAAGGGAGAAAAGGAAAGG - Intergenic
996540024 5:124620924-124620946 ATGGTAAGGAACAAAGAGGATGG + Intergenic
996693712 5:126369138-126369160 TGGGGAAGGCAGAAAGGGAAAGG - Intronic
996746640 5:126851899-126851921 TGGGGAAGGCAGACAGAGGTTGG - Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
996917395 5:128728849-128728871 TTGGGAGGGGAGCAAGAGGAGGG - Intronic
997038883 5:130227793-130227815 ATGGGAATTGGGAAAGAGGAAGG - Intergenic
997258462 5:132447161-132447183 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997888853 5:137657542-137657564 AAGGGAAGGAAGACACAGGAGGG - Intronic
997954207 5:138265654-138265676 AGGAGAAGGAAGAAAGAAGAGGG - Intronic
998541323 5:142984162-142984184 GAAGGAAGGCAGGAAGAGGAAGG + Intronic
998547598 5:143044297-143044319 ATGAGAAGCCAGAAGAAGGAAGG - Intronic
999287305 5:150401895-150401917 ATGGGAAGGCACAGGGAGAAGGG - Intronic
999584710 5:153077324-153077346 AGGGTAAGGGAAAAAGAGGATGG + Intergenic
1000045116 5:157516067-157516089 ATGGGAAGGCAGGAAAGGGGAGG - Intronic
1000190745 5:158908443-158908465 ATGGGAAAGGAAAAAGATGAGGG - Intronic
1000209826 5:159098755-159098777 AGGGGAAGAAAGGAAGAGGAAGG + Intronic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000329922 5:160198268-160198290 AGAGGAAGGCAGGAAGAGGAAGG + Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1000882672 5:166715838-166715860 ATTCGAAGACAGGAAGAGGAGGG - Intergenic
1000899908 5:166900302-166900324 AAAGGAAGGAAGGAAGAGGAAGG + Intergenic
1001034063 5:168284354-168284376 ATGGGGAGGTAGAGAGTGGAGGG + Intergenic
1001206626 5:169769446-169769468 CTGGGATGGTAGAAAGAGAATGG + Intronic
1001320940 5:170680928-170680950 GGAGGGAGGCAGAAAGAGGAAGG + Intronic
1001681521 5:173561074-173561096 AAAGGAAGTCAGAAAGAGGCCGG - Intergenic
1001720222 5:173851042-173851064 AAGGGAGGGAGGAAAGAGGAAGG + Intergenic
1001757617 5:174182657-174182679 ATGGCTAGGGAGAAATAGGACGG - Intronic
1001810434 5:174623486-174623508 CAGGGAAGGATGAAAGAGGAAGG - Intergenic
1002092974 5:176815627-176815649 ATGCGAAGGAACACAGAGGAAGG - Intronic
1002306692 5:178287713-178287735 CTGGGATGTCAGAAAGAGTAGGG - Intronic
1002367000 5:178721092-178721114 AGGTGAAGGAAGAAAAAGGATGG - Intronic
1002434990 5:179225740-179225762 GGGGGAAGCCAGAAGGAGGATGG - Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1003004266 6:2366414-2366436 AAGGAAGGGAAGAAAGAGGAAGG + Intergenic
1003097656 6:3155382-3155404 ACTGGAAGGAAGAAAGAGCAAGG - Intronic
1003101340 6:3178689-3178711 ACTGGAAGGAAGAAAGAGCAAGG - Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003664731 6:8100438-8100460 AAGGGAAAGCAAAAAGAGAAGGG + Intronic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1003879381 6:10466339-10466361 ATTTGAAGGCAGGAGGAGGAGGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004131216 6:12921667-12921689 AGGGAAAGGAAGAAGGAGGAAGG + Intronic
1004151694 6:13126297-13126319 AGGGGCAGGGAGAAAGAGAAGGG + Intronic
1004171369 6:13297830-13297852 AAGGGCAGTCAGAAAGATGATGG + Intronic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004782598 6:18927858-18927880 ATGGTAAAGCAGCAAGAGAAAGG - Intergenic
1005450070 6:25963494-25963516 TAGGGAAGGCAGAAAGAAGATGG - Intronic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1005896649 6:30184911-30184933 ATGGGAAGACAGGGAAAGGAAGG - Exonic
1005926537 6:30450010-30450032 ATGGGAAGGCATAGAGAAAAAGG + Intergenic
1005993727 6:30919655-30919677 ATAAGAAGGTAGAAAGTGGAAGG - Intronic
1006180536 6:32151093-32151115 ATTGGAAGGAAGAAGGAGGGGGG - Intronic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006502911 6:34469457-34469479 ATTGGCAGGCAGGTAGAGGAGGG + Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007354531 6:41303120-41303142 ATCCCATGGCAGAAAGAGGAAGG - Intergenic
1007553451 6:42746944-42746966 AGGGCAGGGAAGAAAGAGGAAGG - Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007741009 6:44009535-44009557 GAGGGAAGGAAGAAAAAGGAAGG + Intergenic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1008248872 6:49212462-49212484 ATGGAAAGCCAAAAAGAGCAAGG + Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009050097 6:58264720-58264742 ATATTAAGGCAGAAAGAGGATGG - Intergenic
1009828392 6:68897593-68897615 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1009828422 6:68897724-68897746 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010141356 6:72618613-72618635 ATGGGTAGGCATGAAGAAGAAGG + Intergenic
1010922808 6:81704816-81704838 AAGGGAGGGAAGAAAGAGTAGGG + Intronic
1011229925 6:85149418-85149440 AAAGGAAGGCAAAAAAAGGAAGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011958685 6:93057762-93057784 ATGGGAAGGGAAATAGAGAAAGG + Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1013041504 6:106438475-106438497 ATGGGAAGCTAGGAAGAGCAAGG - Intergenic
1013269636 6:108534018-108534040 AGGGGAAGGGAGAAAGAAAAAGG + Intergenic
1013299873 6:108794963-108794985 ATGTGAAGACAGAGAAAGGAAGG - Intergenic
1013473054 6:110482604-110482626 ATGGTAATGCAGGAAAAGGATGG - Intergenic
1013588569 6:111601117-111601139 TTGGGAGGGAAGAAAGGGGATGG + Intronic
1013657042 6:112256805-112256827 CTGGGCAGGCAGACAGAAGAGGG - Intergenic
1014262722 6:119238003-119238025 AAGAAAAGGCAGAAAGAGCAGGG - Intronic
1014459062 6:121673572-121673594 ATGTGAAGGGAGCAAGGGGAAGG - Intergenic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1014806124 6:125831902-125831924 ATGGGCAGGCATATAGGGGATGG - Intronic
1014888768 6:126816148-126816170 ATGGAAGGAAAGAAAGAGGAAGG - Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015190192 6:130463976-130463998 ATGGAAGGGAAGGAAGAGGAGGG - Intergenic
1015195490 6:130521007-130521029 GTCGGAAGGCAGGAAGAGGAGGG - Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015509437 6:134023287-134023309 ATAGGATGGCAGATATAGGAAGG + Intronic
1015874522 6:137809291-137809313 GTGGGCTGGCAGAGAGAGGAGGG - Intergenic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1016355557 6:143214561-143214583 ATGGGAAGGCAGGAAGACAAGGG - Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017688623 6:156940528-156940550 ATTGGAAGCCTGAAAGAGAATGG + Intronic
1017853077 6:158322831-158322853 ATGGAAATGCAAATAGAGGAAGG - Intronic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018092909 6:160360959-160360981 AGGGGTAGGGAGTAAGAGGAGGG + Intronic
1018175058 6:161171406-161171428 AGGGGAAGGCAGAAGGCAGAAGG + Intronic
1018205806 6:161436197-161436219 ATGGGAGGGCAGAGAGCAGAGGG + Intronic
1018317458 6:162570809-162570831 TTGGGAAGGTAGAGGGAGGATGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018441996 6:163821971-163821993 ATGGGAAGGCAGAGATGGGGGGG + Intergenic
1018609452 6:165633472-165633494 CTCGGAAGGGAGAAAGAAGATGG + Intronic
1018754873 6:166840358-166840380 GTGGGGAGGTAGAGAGAGGAAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019680566 7:2346336-2346358 CTGGGGAGGCCGAAACAGGAGGG + Intronic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019919969 7:4157281-4157303 AGGGGAAGGAAGAAAGGGAAGGG + Intronic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020012474 7:4814115-4814137 TTTGGAAGGCAGAAAGCAGATGG - Intronic
1020032935 7:4945569-4945591 AAAGGAAGGGAGAAAGGGGAGGG - Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020542538 7:9477194-9477216 ATGGGAAGGCAGACTTAGAAAGG - Intergenic
1020784186 7:12554336-12554358 AAGAGAAGGCAGAAAAATGAAGG - Intergenic
1021128258 7:16880053-16880075 AGGGGAAGGAAGGAAGGGGAAGG - Intronic
1021308716 7:19064474-19064496 ATGAGATGGTAGAAAGATGATGG - Intronic
1021371962 7:19860396-19860418 AACGGAAGAAAGAAAGAGGAAGG + Intergenic
1022028493 7:26470024-26470046 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1022072142 7:26926751-26926773 GTGGGAAGGAAGGAAGAAGAGGG - Intronic
1022523896 7:31025083-31025105 ATGGGTAGGCAGGAATAGCAGGG - Intergenic
1022603445 7:31784418-31784440 ATGGGGAGGCAGAAATAGCTTGG - Intronic
1022774642 7:33513290-33513312 ATGGGAAGCCAGAATAAAGAGGG - Intronic
1022894331 7:34734399-34734421 ATGGGAATGGAGAAACAGGCAGG + Intronic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023135462 7:37047292-37047314 AAGGAAAGGCAGAGACAGGAAGG - Intronic
1023747586 7:43336052-43336074 AGGGGAAGAAAGAGAGAGGAAGG - Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024099068 7:46010704-46010726 CTGGGAGGGCAGCAAGAGAAAGG - Intergenic
1024979612 7:55146342-55146364 ATGGGGAGGAAGGAAGAGAATGG - Intronic
1025860296 7:65320709-65320731 AAGGAAATGCGGAAAGAGGATGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026376554 7:69757093-69757115 AGAGGAAGGCAGAAAAGGGAAGG - Intronic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1027424888 7:78052349-78052371 AGAGGAAGCAAGAAAGAGGAGGG - Intronic
1027560413 7:79721711-79721733 ATGGGAAAGAAGAGAGATGAGGG - Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1027972643 7:85105167-85105189 GGGGGAAGGCAGAAATAGAAAGG - Intronic
1028325017 7:89512866-89512888 ATGAGAGGGCAGAGAGAAGAAGG - Intergenic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1028847792 7:95501789-95501811 ATGAGAAGGAAGAAAGAGGTAGG + Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029612789 7:101636297-101636319 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1030021424 7:105278747-105278769 AGGGGAAGGCAGAAGGCGGAAGG + Intronic
1030021431 7:105278767-105278789 AGGGGAAAGGAGAAAGGGGAAGG + Intronic
1030153685 7:106430515-106430537 AAGGCAAGGCAGAAAGTGAAGGG - Intergenic
1030170398 7:106596148-106596170 AAGGGAAGGAAGAAAAAGAAAGG + Intergenic
1030172636 7:106619257-106619279 ATAGGTAGGCAGGAAGGGGAAGG + Intergenic
1030645689 7:112058873-112058895 AAGTGAAGGCAGAAAGAAGAAGG + Intronic
1030977645 7:116146435-116146457 AGTGGAGGGCAGAAAGAGGTTGG + Intronic
1031014904 7:116562905-116562927 AGAGGAAGGAAGGAAGAGGAAGG + Intergenic
1031971729 7:128069489-128069511 ATGAGGTGGCAGAAAGAGCATGG - Intronic
1032489645 7:132314549-132314571 TAGGGAAGGGAGGAAGAGGAAGG + Intronic
1032947600 7:136870510-136870532 ATGGGCAGGAAGATAGAGAAAGG - Intronic
1033119344 7:138653101-138653123 ATGGGAAGGCTAAGAGAGGTGGG + Intronic
1033302901 7:140202096-140202118 AAGGGATGGGAGAAAGGGGATGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033609630 7:142953343-142953365 AGGGGAAGAAAGGAAGAGGAGGG - Intronic
1033652271 7:143352264-143352286 AGGGGGAGGCAGAGAGAGGCAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034427064 7:151019528-151019550 AAGGGAGGGCAGAAAGAGAAAGG - Intronic
1035041702 7:155933518-155933540 AGGGGAGGGGAGAAAAAGGAAGG + Intergenic
1035453327 7:158993097-158993119 AAAGGAAGGCAGGAAGGGGACGG - Intergenic
1035524090 8:298737-298759 GTGGGAAGGAAGGAAGAGGGTGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036487229 8:9190218-9190240 ATGGGAGGGAGGAAAGAGGAAGG - Intergenic
1036576570 8:10032983-10033005 AAGGGAAGGAAGGAAGGGGAGGG - Intergenic
1037014143 8:13881658-13881680 ATCGGGAGGCAGAGAGAGGTGGG + Intergenic
1037584767 8:20268828-20268850 ATGGAAAGGCAGAAAGTGAAAGG + Intronic
1037643387 8:20769179-20769201 GTGAGAAGAGAGAAAGAGGAAGG + Intergenic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038415077 8:27389239-27389261 ATAGGAAGGCAGAGAGAGGAGGG + Intronic
1038523819 8:28256456-28256478 AAGGGACGGGAGAAAGAGAAAGG + Intergenic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038927251 8:32154358-32154380 AAAGGAAGGCAGGAAGTGGAAGG - Intronic
1038927262 8:32154402-32154424 TGGGGAAGGCAGGAAGTGGAAGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1039323024 8:36453493-36453515 ATGAGAAGGAAGGAAGAAGAAGG - Intergenic
1039364540 8:36916222-36916244 AAGGGAAGGCAAAGAAAGGAAGG + Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1039995837 8:42532336-42532358 TGGGGAAGGCAGGAAGAGAAAGG - Intronic
1040894217 8:52349179-52349201 AAGGGAAGGGAGAAAGAAGAAGG - Intronic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1041641391 8:60206727-60206749 ATGGGAAGGAAGAAAGAAGGAGG - Intronic
1041693918 8:60715619-60715641 AGTGGAAGCCAAAAAGAGGAAGG - Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042009907 8:64231550-64231572 ATGGGATAGCAGAAAGATCATGG - Intergenic
1042064918 8:64864196-64864218 AAGGGAAGGAAGGAAGAGGGAGG + Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042705084 8:71658153-71658175 ATGGGAAATCAGAGAGAGAAAGG - Intergenic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1042833680 8:73058072-73058094 ATGGAAAGGCAAAAAAAGCAGGG + Intergenic
1043021859 8:75011994-75012016 TTGTGAAGGAAGAAAGAGTAGGG + Intronic
1043026493 8:75076742-75076764 ATGGGAAGGCAAGGAGAAGAGGG - Intergenic
1043276284 8:78399193-78399215 ATTGGAAGGAATGAAGAGGATGG - Intergenic
1043417272 8:80063989-80064011 AGGGGAAGGAAGAAAGAGAGGGG + Intronic
1044113814 8:88309390-88309412 ATGGGAAGGAAGGCAGGGGAAGG + Intronic
1044115541 8:88328841-88328863 ATGGTTTGGCTGAAAGAGGAAGG + Intergenic
1044218062 8:89636102-89636124 AGGGGAAGGCAGAATTAGGTAGG - Intergenic
1044605660 8:94045202-94045224 ATAGGAAGGAAGGAAGAGGCAGG - Intergenic
1044621554 8:94195592-94195614 ATGGGAAGCCTTAAGGAGGAAGG - Intronic
1044824507 8:96183549-96183571 AAGCGCAGGCAGAAAGAGGTGGG + Intergenic
1044952118 8:97445039-97445061 AAGGGAAAGCAAAAAGAGAAAGG - Intergenic
1044953153 8:97452915-97452937 ATTGGAAAGAAGAAAGAAGAAGG + Intergenic
1045317132 8:101052864-101052886 ATGGCAGGGCAGAGGGAGGATGG - Intergenic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045888791 8:107129818-107129840 ATAGGAAGGGGGAAAGAGGAAGG + Intergenic
1045942513 8:107755420-107755442 ATGGGAAGCCAGAAGGGAGATGG - Intergenic
1046079593 8:109355140-109355162 ATGTGTAGGCATATAGAGGAAGG - Intergenic
1046101277 8:109616832-109616854 CTGGGAATGCAAAAAGAGGATGG + Intronic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046555487 8:115768460-115768482 AAGGGAAGGGAGGAAGAGAAGGG - Intronic
1046555503 8:115768517-115768539 AAGGGAAGGGAGGAAGAGAAGGG - Intronic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1047562586 8:126005039-126005061 AATGGAAGGTAGAAAGAAGAAGG + Intergenic
1047725434 8:127679964-127679986 TGGGGAAGGGAGAAAGGGGAAGG + Intergenic
1048128570 8:131665465-131665487 ATTGGAAGACAGGAAGATGAAGG - Intergenic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048248818 8:132840260-132840282 ATGGGAAGGGAAGGAGAGGATGG - Intronic
1048292711 8:133192697-133192719 CTGGGAGGGCAGGGAGAGGATGG + Intronic
1048462705 8:134635788-134635810 ATGAGATGGTTGAAAGAGGAAGG - Intronic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048821384 8:138383863-138383885 ATGGGAACCAAGACAGAGGATGG - Intronic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1048849904 8:138634967-138634989 ATGTCAAGGCCGAAAGAGGAGGG + Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049402146 8:142433230-142433252 AAGGGAAGGAGGAGAGAGGATGG - Intergenic
1049824743 8:144661533-144661555 TTGGGAGGGGAGAAAGGGGAAGG - Intergenic
1050085100 9:1957141-1957163 CTGGGAAGGCAGGAAGCGGAAGG - Intergenic
1050429566 9:5548913-5548935 ATTGGAGGCCAGAAAGAGGACGG - Intronic
1050772807 9:9224308-9224330 ATGGGGAGGGAGAAAGGGAAAGG + Intronic
1050802304 9:9630370-9630392 AGGAGAAGGCAGGGAGAGGATGG + Intronic
1051408519 9:16764930-16764952 AAGGGAAGGAAGAAAAAAGAAGG + Intronic
1051718968 9:20015678-20015700 ATGAGAAGACAGAAAGTGGGTGG - Intergenic
1052041710 9:23746637-23746659 ATAGGCAGGCAGAAAGAGAGAGG + Intronic
1052580968 9:30353261-30353283 ATGGAAAGGCTGAAAGAAAAAGG - Intergenic
1052712845 9:32078170-32078192 TCACGAAGGCAGAAAGAGGAAGG - Intergenic
1052742427 9:32405998-32406020 GTGCAAAGGCAGAAAAAGGACGG - Intronic
1052778124 9:32753686-32753708 GTGGGAGGGCAGGAAGAGAAAGG + Intergenic
1052939763 9:34123600-34123622 TTAGGAAGACAGAAAGAGGTAGG + Intronic
1053166064 9:35844777-35844799 ATGGGAATGCAGAGAGGGAAAGG - Intronic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054453873 9:65419962-65419984 AGGGGAAGGGAGAAATGGGAGGG + Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055112806 9:72576334-72576356 GAAGGAAGGGAGAAAGAGGAGGG - Intronic
1055520954 9:77080687-77080709 GTGGGAACACAGAAAGAAGATGG - Intergenic
1055657171 9:78462523-78462545 AAGGGATTGCAGAAAGAAGAAGG + Intergenic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1055869337 9:80855336-80855358 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1056321091 9:85435143-85435165 AAGGGAAGCCAGAGAGAGAAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057013862 9:91633053-91633075 AAAGGAAGGAAGGAAGAGGAGGG + Intronic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058606783 9:106731383-106731405 CTGGGAAGGAGGAAAGAGAAAGG + Intergenic
1058832375 9:108830902-108830924 CTGGGAAGGCACAGAGAAGATGG + Intergenic
1059354261 9:113687179-113687201 AGGAGGAGGAAGAAAGAGGAAGG + Intergenic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1059479240 9:114575622-114575644 ATGGGAGGGCAGCAGGAGAATGG - Intergenic
1059897478 9:118883149-118883171 GTGGGAAGAAAGAAAGCGGAGGG - Intergenic
1059987544 9:119835288-119835310 GTAGGAAGGAAGAGAGAGGAAGG + Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060190320 9:121588528-121588550 AAGGGAAGGGGGAAAGGGGAAGG + Intronic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060212242 9:121717759-121717781 AGGGGAAGAGAGAAAGAAGAGGG - Intronic
1060518323 9:124279605-124279627 AAGTGAAGTCAGAAAGAGAAAGG - Intronic
1060716326 9:125933232-125933254 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
1060892398 9:127197080-127197102 ATGGGAAGCTAGAAGGAGGGAGG + Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1061331881 9:129899787-129899809 AAGGGAAGGAAGGAAGGGGAAGG + Intronic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061560078 9:131396281-131396303 AAGGGAAGGAAGGAAAAGGAAGG - Intronic
1061595811 9:131628503-131628525 ATGGGAAGGCAGGGAGGGGGTGG - Intronic
1062085500 9:134645995-134646017 AAGGGAAGGAAGGAAGGGGATGG - Intronic
1062227608 9:135462169-135462191 TTGGGAATGCAGAAAAAGGGAGG - Intergenic
1062483237 9:136762132-136762154 ATGGGAAGGGAGGGAGAGGCTGG + Intronic
1062638431 9:137503662-137503684 AGGGGAAGGAAGAAGGAGAAGGG + Intronic
1062714332 9:137998635-137998657 AGGTGAAGGTAAAAAGAGGACGG + Intronic
1203732497 Un_GL000216v2:103597-103619 ACGGGGGGGCAGAAAGAGGCTGG - Intergenic
1203553949 Un_KI270743v1:190368-190390 ATGGGAAGCTGGAAAGGGGATGG + Intergenic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185662002 X:1735487-1735509 AGGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185714582 X:2330715-2330737 AGGGGAAGGAAGAAGTAGGAGGG + Intronic
1185768824 X:2749184-2749206 AAGGAAAGGAAGAAAGAGAAAGG - Intergenic
1185954894 X:4478462-4478484 AGGGGAGGGAAGAGAGAGGATGG + Intergenic
1186036474 X:5428882-5428904 ATGGGGAGCCGGAAAGGGGATGG + Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186196045 X:7111131-7111153 ATGGCAAGGCAGCAGGAGAAAGG - Intronic
1186206317 X:7204596-7204618 AAGGGAAGGAAGAAAGAAGATGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186478300 X:9876479-9876501 CTAGGAATGGAGAAAGAGGAGGG - Intronic
1186627220 X:11307176-11307198 CTGGGAAGGAAGATAGCGGAGGG - Intronic
1186789346 X:12981894-12981916 AAGAGAAGGCAAACAGAGGAAGG - Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187355410 X:18565788-18565810 AAGGGAAGGTAAAAAGTGGAAGG + Intronic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188205561 X:27353058-27353080 ATAGGAAGGAAAAAAGAGCACGG + Intergenic
1188759218 X:34004953-34004975 ATGGGAGGGTAGAAACATGAGGG - Intergenic
1188939357 X:36217527-36217549 ATGGGAGGGCAGCAGGAGAAAGG - Intergenic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189175616 X:38954389-38954411 ATGGAACGGTAGAGAGAGGAGGG - Intergenic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189369191 X:40414313-40414335 AAGGGAAGGCAGAAAATAGACGG + Intergenic
1189496890 X:41516669-41516691 ATAGGAAGCAAGAAGGAGGAGGG + Intronic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1189966672 X:46380433-46380455 AAAGGAAGGAAGAAAGAGGGAGG + Intergenic
1190113164 X:47608289-47608311 AGGGGAAGGAAGGAAGGGGAAGG + Intronic
1190259110 X:48786837-48786859 ATGAGAGGGCAGAAAGAGGTGGG - Intronic
1190515892 X:51223274-51223296 AAAGGAGGGAAGAAAGAGGAGGG - Intergenic
1190581304 X:51894683-51894705 TGGGGAATGCAGAAAGAGGGAGG - Exonic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1190916997 X:54818340-54818362 GTGGGAAGGGAGGAAGAGGCGGG - Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191798311 X:65047731-65047753 ATGGGTAGGCTGAAAGAAAATGG - Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192050067 X:67716644-67716666 AATGCCAGGCAGAAAGAGGATGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192112192 X:68376446-68376468 ATGGAAAGGGAGAAAGAGATAGG + Intronic
1192327734 X:70147452-70147474 AGGGGAAGAGAGGAAGAGGATGG + Intronic
1192434669 X:71135913-71135935 AGAGGAAGACAGAAAAAGGAAGG - Intronic
1193103008 X:77636935-77636957 AGGAGAAGGAAGAAGGAGGAAGG + Intronic
1193170239 X:78327657-78327679 AGGGGAAGGGTCAAAGAGGAAGG + Exonic
1193315319 X:80058146-80058168 AAGGGAAGGGAGAAAAAGGAAGG + Intergenic
1193422279 X:81295860-81295882 AGAAGAAGGCAGAAAGATGATGG - Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1194368886 X:93046394-93046416 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194654684 X:96558316-96558338 ATGAGATGACAGAAAGAAGAAGG + Intergenic
1194736982 X:97524050-97524072 ATGGTAAGGAGCAAAGAGGAGGG - Intronic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1194936682 X:99958468-99958490 GTGGGAAGGCTGAAAAAGCAGGG + Intergenic
1194954179 X:100160407-100160429 ATGGGAAAGCAGAAAAGGGCAGG - Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195519482 X:105814561-105814583 ATGGGAAGTCACAAGGAAGAAGG - Intergenic
1196150250 X:112365722-112365744 ATGGGATTACAGAAAGAGCACGG - Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196716965 X:118821613-118821635 ATAAGAAGGCAGAAAGAAGCAGG + Intergenic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197196746 X:123710006-123710028 AGGGAAGGGCAGAAAGAGAAAGG + Intronic
1197641252 X:128970646-128970668 TTGAGAAGGCAGAAAAGGGATGG - Intergenic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1198213452 X:134535712-134535734 ATGGGAGGGCAGGAAGAGCTGGG + Intergenic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198606107 X:138339506-138339528 ATGGGAAGGATGGAAGTGGAGGG + Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199269440 X:145865460-145865482 CTGGGAAGAGAGAAAGAGGGAGG + Intergenic
1199482309 X:148311180-148311202 ATGGGAAAGCAGAAAGCCGCAGG + Intergenic
1199600237 X:149537324-149537346 AGGGGAAGGCAGGAGCAGGACGG + Intergenic
1199650347 X:149942616-149942638 AGGGGAAGGCAGGAGCAGGACGG - Intergenic
1199703497 X:150404000-150404022 AAAGGAAGGAAGAAAGAAGAAGG + Intronic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199963396 X:152797771-152797793 TTGGGAAGGAAGAAAGAACATGG - Intergenic
1200677089 Y:6162727-6162749 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1200740594 Y:6849808-6849830 CTGGGAAGGAAGATAGGGGAGGG + Intergenic
1200906239 Y:8485551-8485573 AATGGAAGGCAGGAAGAGAATGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1201146483 Y:11067729-11067751 AGAGGAAGGGAGAGAGAGGAAGG + Intergenic
1201300171 Y:12498418-12498440 AAGGCAAGAGAGAAAGAGGAAGG - Intergenic
1201323285 Y:12724927-12724949 ATGGGATTTCAGAAAAAGGAAGG - Intronic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201540109 Y:15096752-15096774 ATGGAAAGGGAGAGAGAGGGAGG - Intergenic
1201550095 Y:15210328-15210350 AAGGGAAGGGAGAAAAGGGAGGG + Intergenic
1201625598 Y:16011705-16011727 GGAGGAAGGGAGAAAGAGGAAGG + Intergenic
1201652652 Y:16307413-16307435 AGAGGAAGACAGAGAGAGGAGGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202127090 Y:21578076-21578098 ATGGGCAGTTAGAAAAAGGATGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202371558 Y:24200977-24200999 TAGGGAAGGAAGAAAGTGGAGGG - Intergenic
1202376490 Y:24242809-24242831 TAGGGAAGGAAGAAAGTGGAGGG - Intergenic
1202494290 Y:25427310-25427332 TAGGGAAGGAAGAAAGTGGAGGG + Intergenic
1202499227 Y:25469139-25469161 TAGGGAAGGAAGAAAGTGGAGGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic