ID: 1038570546

View in Genome Browser
Species Human (GRCh38)
Location 8:28658345-28658367
Sequence GAGGGTGAAAACAGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 502}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038570546_1038570550 -7 Left 1038570546 8:28658345-28658367 CCATCCACCCTGTTTTCACCCTC 0: 1
1: 0
2: 4
3: 52
4: 502
Right 1038570550 8:28658361-28658383 CACCCTCCCTAATCCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038570546 Original CRISPR GAGGGTGAAAACAGGGTGGA TGG (reversed) Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
901317034 1:8316423-8316445 CAGAGTGAAAACAGATTGGAGGG - Intergenic
901664452 1:10818540-10818562 GAGGTTGAAAGCAGGTGGGAGGG + Intergenic
902664245 1:17926437-17926459 GAGGCTGGAAACAGGGTTTAAGG - Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902909039 1:19581516-19581538 GAGAATGAAAACAGGAAGGAAGG + Intergenic
903232035 1:21927723-21927745 GAAGGAGCAATCAGGGTGGAAGG + Intronic
903375927 1:22865982-22866004 TAGAGAGAGAACAGGGTGGAGGG - Intronic
904287578 1:29462062-29462084 GAGGGTACAACCAAGGTGGAAGG + Intergenic
904304355 1:29577963-29577985 GAGGGAGTAAACTGGGTGGACGG + Intergenic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904752812 1:32751538-32751560 GATGGTGAACACGGGGTGCAGGG + Intronic
905264110 1:36739339-36739361 GATGGGGAGTACAGGGTGGAGGG - Intergenic
905488960 1:38328736-38328758 AAGGGTGGAAACAGGGTGAGAGG - Intergenic
905770940 1:40637372-40637394 CAGGCTGAGAACAGGGTGCAGGG + Intronic
907868881 1:58424916-58424938 GTGGGTGAACACAGTTTGGAAGG + Intronic
908564282 1:65338622-65338644 GAGGGAGGGAACAGGGTAGAGGG - Intronic
909057311 1:70837165-70837187 GAGGGTGAAAATAGATTGAAAGG + Intergenic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909695131 1:78459636-78459658 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
910603383 1:89055583-89055605 GAGGGAGAAAACTGTGGGGATGG + Intronic
910637332 1:89423531-89423553 GAGGGAGAAAACTGTGGGGATGG - Intergenic
910673071 1:89792687-89792709 GAGGAAGAAAGCAAGGTGGAAGG + Intronic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912902081 1:113662194-113662216 AAGGGGGAAAAAAGGATGGAGGG - Intronic
912940587 1:114041359-114041381 GAGGGTGGAAAATGGATGGATGG - Intergenic
913329412 1:117654659-117654681 AAGGCTGAAAACAGGCAGGAAGG + Intergenic
914944347 1:152050849-152050871 TAGGATGAAAGCAGGGAGGAAGG + Intergenic
915338458 1:155162366-155162388 GAGGCTGAAAACAGAAAGGAGGG + Intergenic
915357311 1:155262994-155263016 GAGGGTGGAAACTGTGTGGATGG + Exonic
915734963 1:158078717-158078739 GAGGCTGAAAACTGGGGTGAGGG + Intronic
916689332 1:167175538-167175560 TAGGGTGACAACATGGAGGAGGG + Intergenic
916734656 1:167597247-167597269 GAGGTTGAAATCATGGCGGAGGG + Intergenic
918121520 1:181545192-181545214 GGGGATGAAAACAGGTTGGGTGG + Intronic
918325910 1:183410590-183410612 GAGCCAGAAAACAGGTTGGAAGG - Intronic
919713212 1:200749097-200749119 TAGGATGCAAACAGGGAGGAAGG + Intronic
919864979 1:201774456-201774478 GTGGGAGAAAAAAGGCTGGATGG - Intronic
920256692 1:204660193-204660215 GAAGGAGAAACGAGGGTGGACGG - Intronic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921778182 1:219127176-219127198 GAGGGGAAAAACAGAGGGGAGGG - Intergenic
922079702 1:222283842-222283864 GAGGGGGAACACAGGCAGGAAGG + Intergenic
922859568 1:228804643-228804665 GAGGAAGAAAAGAGGGAGGAAGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924737353 1:246770070-246770092 GAGGGTGGAGAGTGGGTGGAAGG - Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063033811 10:2264690-2264712 GATAGTGAAAACAGAGTGTAAGG + Intergenic
1063954430 10:11253218-11253240 GAGGGTTAAAGCAGGATGGATGG - Intronic
1064172689 10:13047934-13047956 AAGGGGGAAAGCAGGCTGGAGGG + Intronic
1064300346 10:14117661-14117683 GAAGGTGGAAGGAGGGTGGAAGG + Intronic
1065261369 10:23926792-23926814 GAGGAAGAAAAGAGGGAGGAAGG - Intronic
1065417629 10:25505679-25505701 GAGGGTGCTAACAGGGAGGCTGG - Intronic
1065636102 10:27736151-27736173 GAGAGTGAAAGCAGGGTCAAGGG + Intronic
1065899818 10:30196092-30196114 GAGGGTGAAGGCTGGGAGGAGGG - Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066285903 10:33965931-33965953 GGTGGTGAAAACAGGGTGGTGGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067783135 10:49223451-49223473 GAGGCTGGAGACAGGGTGGCTGG + Intergenic
1067897493 10:50200067-50200089 GAGGGTGAAGGCTGGGAGGAGGG - Intronic
1067951482 10:50741970-50741992 GAGGGTGAAGGCTGGGAGGAGGG + Intronic
1069942926 10:71967316-71967338 GAGGGTGGAGACAGTGGGGAGGG - Intronic
1069955187 10:72045966-72045988 GAGTGTGAGGACAGGGTGCAGGG + Intergenic
1070707142 10:78647907-78647929 GAGCATGAACACAGAGTGGAGGG - Intergenic
1071245757 10:83760996-83761018 GAGGATGACAACAGGAAGGAGGG + Intergenic
1071751143 10:88477527-88477549 GATGGTGAAGACAGGGATGATGG + Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1072916477 10:99540311-99540333 GGGGGTGGAAACAGGGGGGTGGG + Intergenic
1073378736 10:103060773-103060795 AAGGTTGAAAACAGGGTGGAAGG + Intronic
1073458779 10:103653622-103653644 CAGGGTGACAGCATGGTGGAGGG + Intronic
1073762383 10:106644036-106644058 GCAGGTAAACACAGGGTGGAAGG + Intronic
1074447389 10:113531650-113531672 GAGGATGGAAACAGGTTAGAAGG - Intergenic
1074905355 10:117857905-117857927 GAGAGTGAAGCCAGTGTGGAGGG + Intergenic
1075162531 10:120037096-120037118 GAGGGTGGAAGGTGGGTGGAGGG + Intergenic
1076193293 10:128498063-128498085 GAGGGTGAATACTGGGTCGTGGG + Intergenic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076667739 10:132102645-132102667 GAGGGTGAAAGGAGGGTCGGAGG - Intergenic
1077426351 11:2480440-2480462 GAGAATGAAAACAGAGTGCAAGG + Intronic
1077915452 11:6608828-6608850 GAGGGAGAAGACAGGTGGGAAGG - Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078052125 11:7974929-7974951 GGGGCTGAAAACAGGGTAGCAGG + Intronic
1078084950 11:8228336-8228358 GAGGCTGAGAAGAGGGTGGGGGG + Intronic
1078109302 11:8379767-8379789 GAGGGTGAAGGGTGGGTGGAGGG - Intergenic
1079246230 11:18754254-18754276 CAGGATGCAAACAGGGTGAAGGG - Intronic
1079334756 11:19561754-19561776 GGGGGTTAAAACAGAGTGCAAGG - Intronic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079964382 11:26963149-26963171 GAGGGAGAAAAAAGAGAGGAAGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080394001 11:31873428-31873450 GAGGGAGAGAAGAGGGTGGTTGG + Intronic
1081213402 11:40363407-40363429 GAGGGTGAAGGCTGGGAGGAGGG + Intronic
1083213430 11:61203688-61203710 GAGGGAGAAAAAAGGGAAGAAGG - Intronic
1085462118 11:76700479-76700501 GAAGGGGAAACCAAGGTGGATGG + Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086437129 11:86792445-86792467 GGAGGTGAAGACAGGGTAGAGGG - Intronic
1086955662 11:92932479-92932501 GAGGGAGAAAGAAGGGAGGAAGG - Intergenic
1087741144 11:101888355-101888377 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1088815841 11:113420179-113420201 GAGGAGGAAGACAGGGAGGAAGG - Intronic
1088877423 11:113947505-113947527 CAAGGTGCAAACAGGGTGGGTGG + Intergenic
1089085030 11:115809710-115809732 GAGGCTGAGGACAGGCTGGAGGG - Intergenic
1089597165 11:119587897-119587919 GAGGGTGAAGACAGAGAGAAGGG - Intergenic
1089818094 11:121194742-121194764 GAAGTTCAAAACAGGGTGGATGG - Intergenic
1090044219 11:123316855-123316877 GAGGGAGGAAGCAGGGAGGAAGG + Intergenic
1090872168 11:130758226-130758248 GAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1091934794 12:4426573-4426595 CCGGGTGAAAGCAGGGAGGAGGG + Intergenic
1092024472 12:5229247-5229269 GAGGGTGAAATCATGGAAGAGGG + Intergenic
1093481637 12:19610080-19610102 GAGGGTGGAGACTGGGAGGAGGG - Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094689397 12:32754349-32754371 GAAGGAGAAAACTGGGTGAAGGG + Intronic
1096016977 12:48285532-48285554 GTGGGACAAAACAGGCTGGAAGG - Intergenic
1096474875 12:51902478-51902500 GAGCGCAATAACAGGGTGGAAGG + Intergenic
1096712106 12:53465097-53465119 GAAGGTGAAAATGGGGTGGGAGG - Intronic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097693991 12:62759819-62759841 GAAAGTGGAAACAGGGTGGGAGG - Intronic
1098327138 12:69314991-69315013 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1098562432 12:71889782-71889804 GAGGGTGGAAAGTGGGAGGAGGG - Intronic
1099263246 12:80410797-80410819 GAGGGTAAAATCAGTGTGGGAGG + Intronic
1099881698 12:88475182-88475204 GAGGGTAAGAATAGGGTGGGTGG + Intergenic
1100166189 12:91920774-91920796 GAGGGTGAAATTGGGGAGGAGGG - Intergenic
1100175633 12:92027824-92027846 GAGGGTGGAAACCAGGTGGTGGG - Intronic
1100192715 12:92209803-92209825 GATAGTGAAGAGAGGGTGGAAGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100633671 12:96413617-96413639 GTGGGTGAAATCAAGGTGGGTGG - Intergenic
1100751434 12:97702520-97702542 GTGGGTGAAGACACGTTGGAAGG - Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101573652 12:105978368-105978390 GAGGCTGAACACAGGCTGGGAGG - Intergenic
1101825087 12:108213927-108213949 GAGTCTGGAAACAAGGTGGAAGG - Intronic
1102796741 12:115695495-115695517 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1102866894 12:116381862-116381884 GAGGGTTGAAACAGGGAAGATGG - Intergenic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104064706 12:125297185-125297207 CAGTGAGACAACAGGGTGGATGG + Intronic
1104125168 12:125839280-125839302 AAGGGAGAAGACTGGGTGGATGG + Intergenic
1104455310 12:128906484-128906506 GAGTGTGAAAACAGGCATGAGGG - Intronic
1104717117 12:131023421-131023443 GTGGGTGGGAACAGGGTGCAGGG - Intronic
1106384712 13:29272972-29272994 GAATGTGGAAACAGGGAGGAAGG + Intronic
1106584143 13:31042867-31042889 GAGGGTGGAAGGAGAGTGGAAGG + Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1108813052 13:54253589-54253611 GAGGGTGGAAGGTGGGTGGAAGG + Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1110981036 13:81898664-81898686 GAGGGTGAAGGCTGGGAGGAGGG - Intergenic
1111212541 13:85098247-85098269 GAGGTTGAGAACAGTTTGGAGGG + Intergenic
1111495021 13:89036245-89036267 GAGGGTGAAAATTGGGAGAATGG - Intergenic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1111716323 13:91883930-91883952 GGGGGTGAAAGCTGGGAGGAGGG - Intronic
1111745309 13:92260541-92260563 GGGGGTGAAAACAGGATGTAAGG - Intronic
1111948994 13:94694892-94694914 GAAGGAGAGAACAGGGTGGTAGG + Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113791565 13:113031575-113031597 GAGGGAGAATGCGGGGTGGAGGG + Intronic
1113929277 13:113957826-113957848 GGGGGTGAATACAGAGTGCAGGG - Intergenic
1113963659 13:114139686-114139708 GTGGGTGTAGACAGGGTGGTGGG + Intergenic
1113963712 13:114139920-114139942 GTGGGTGTAGACAGGGTGGTGGG + Intergenic
1114221526 14:20701798-20701820 AAGGGGGAATGCAGGGTGGAAGG - Intergenic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115338015 14:32261553-32261575 GAGAGTGAAAACAGAATGCAGGG - Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116282779 14:42929391-42929413 AAGAGTGAAAGCAGGGAGGATGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117846761 14:59920044-59920066 GAGGGGGATAAAAGGGTGGGGGG - Intronic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118215039 14:63800808-63800830 GAGGGTGGAATCTGGGAGGAGGG + Intergenic
1118426459 14:65669028-65669050 GAGGGTGAAAGGTGGGAGGAGGG + Intronic
1120239046 14:81928249-81928271 GGGGGTGAAAACAGGGAGAGAGG - Intergenic
1120769891 14:88367556-88367578 GAGGGTGGAGGCAGGGAGGAGGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121633328 14:95437251-95437273 GAGGGGGCAAGCATGGTGGAAGG - Intronic
1121649078 14:95543689-95543711 GAGGGTGGAAACAGGATGAGAGG + Intronic
1122263575 14:100536486-100536508 GAGGGAGAAAACAGAGAGAATGG + Intergenic
1122650051 14:103221177-103221199 GATGGAGCACACAGGGTGGAGGG + Intergenic
1122716554 14:103699911-103699933 GAGGGTGAAACCATGGCAGAAGG - Intronic
1122856165 14:104561209-104561231 GAGGGTGACAGCAGGCTGGGTGG - Intronic
1123737214 15:23196957-23196979 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124288430 15:28425619-28425641 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1124294794 15:28491695-28491717 GAGGGTGAAAGCTGGGAGGAGGG + Intergenic
1124395255 15:29295041-29295063 GAGGGAGAAAACAGGGTGACAGG + Intronic
1125210728 15:37212316-37212338 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1126371952 15:47956641-47956663 GAGGGTGGAAAGTGGGAGGAAGG - Intergenic
1128259247 15:66221031-66221053 CAGGGTGAAAGCTGGGTGAAGGG + Intronic
1128539018 15:68512075-68512097 GAGGTTGAAAACAGGAGAGAGGG + Intergenic
1132664714 16:1076172-1076194 GAGAGAGAAAACAGGGTAGGGGG - Intergenic
1132792693 16:1701193-1701215 GAGGGTGAGAACAGGATGCTAGG - Exonic
1132896104 16:2230076-2230098 GAGGGTGGGTACAGGGTGGACGG + Intronic
1133415845 16:5606437-5606459 GAGGGAGGAATGAGGGTGGAGGG - Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135604816 16:23814293-23814315 GTTGGAGAAAACTGGGTGGAGGG - Intergenic
1136551445 16:30984521-30984543 GGGAGTGACACCAGGGTGGAAGG - Exonic
1136588418 16:31202377-31202399 GAGGGGAAAGACGGGGTGGAGGG + Intronic
1138250245 16:55496704-55496726 GAGGGAGAGAACAGGGTAGGAGG + Intronic
1139248042 16:65466916-65466938 GAGGATGAAATGAGGGTGGGTGG + Intergenic
1139486919 16:67263051-67263073 GAGCTTGAAAACAGAGGGGAGGG + Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140905877 16:79408664-79408686 GGAGGGGAAAACAGGGAGGAAGG - Intergenic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142008249 16:87700604-87700626 GAGGGAGGAAACAGGGTGGAGGG + Intronic
1142663280 17:1446229-1446251 GAAGGTGAAAGCCGGGTGGGAGG - Intronic
1142766560 17:2067684-2067706 GAGGGTGGAGGCAGGGAGGAGGG + Intronic
1143444421 17:6998967-6998989 GAGGGTGTAAACACGTTTGAGGG - Exonic
1144405032 17:14943930-14943952 GAAGGAGAAAATAGCGTGGAGGG + Intergenic
1145016275 17:19400425-19400447 GAGGGTGAGGACAGGAAGGAAGG - Intergenic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1146403420 17:32518114-32518136 GAGGGTGATGACAGAGTGGCAGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147429419 17:40362610-40362632 GAGGGGGAGAACAGAGCGGAAGG - Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147817600 17:43221323-43221345 GAGGGTGGAAAGAGAGTGGAAGG - Intergenic
1148892667 17:50819412-50819434 GAGGGGGAATACGGGGTGGAAGG + Intergenic
1149436877 17:56640543-56640565 GGGGGAGGAAACAGGATGGAGGG + Intergenic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1150569469 17:66373755-66373777 GATCGTGAAAACAGGAGGGAGGG - Intronic
1152861737 17:82700436-82700458 GAGGAAGAAAAGAGGATGGAAGG + Intergenic
1154257290 18:12794573-12794595 TAGGGTGAAAACTATGTGGATGG - Intronic
1155733431 18:29191195-29191217 CAGGGTGGAAAGAGGGTGAAGGG - Intergenic
1155741556 18:29295324-29295346 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1156467365 18:37356344-37356366 GAGAGTGACAAAAGGGTGGGGGG + Intronic
1156837625 18:41574412-41574434 GATGGAAAAAAGAGGGTGGAGGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157461790 18:47903860-47903882 GAGGGAAAAAACAGTGTGGGGGG + Intronic
1157892081 18:51427426-51427448 AAGGGGAAAAACAGGCTGGAGGG - Intergenic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158168235 18:54566209-54566231 GAGGCTGAATACATGGTGGTTGG - Intergenic
1158171157 18:54602519-54602541 AAGCATGAAAACAGGGAGGAAGG + Intergenic
1158554887 18:58466794-58466816 GAGAGTGAAAACCGAGTGAAAGG - Intergenic
1158760638 18:60381643-60381665 GAGAGGGAAGAAAGGGTGGAGGG + Intergenic
1159314662 18:66756658-66756680 GAGGGAGAAAACAATGTGAATGG + Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159768644 18:72521976-72521998 GAGGAGAACAACAGGGTGGAGGG - Intergenic
1159804820 18:72943528-72943550 GAAGTAGAAAATAGGGTGGAAGG - Intergenic
1160608222 18:80067930-80067952 GGAGGTGAAAGCTGGGTGGATGG + Intronic
1160965268 19:1744608-1744630 GAGGGTGAGAAAGGGGAGGAAGG - Intergenic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161608209 19:5226315-5226337 GTGGGTGTAGACAGGGGGGAAGG - Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1163225306 19:15956503-15956525 GAGGGTGAGAGGAGGGTGCAGGG - Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1165810643 19:38609796-38609818 TAGGGGGAAAACAGGGAGGGAGG - Intronic
1165935386 19:39385523-39385545 GAGGGTGAAATCATGGAGGAGGG - Intronic
1166885992 19:45961156-45961178 GCGGGGGCACACAGGGTGGAGGG + Intronic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1167361639 19:49033333-49033355 CTGGTAGAAAACAGGGTGGACGG + Intronic
1167362016 19:49035452-49035474 CTGGTAGAAAACAGGGTGGACGG - Intronic
1167364069 19:49045408-49045430 CTGGTAGAAAACAGGGTGGACGG + Intergenic
1167364430 19:49047519-49047541 CTGGTAGAAAACAGGGTGGACGG - Intergenic
1167365715 19:49054154-49054176 CTGGTAGAAAACAGGGTGGACGG - Intergenic
1167952165 19:53036587-53036609 GGGGGTGTAAACAGGGAAGAGGG - Intergenic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925017812 2:544937-544959 GAGGGTGAGAACAGGGGCCAGGG - Intergenic
925577896 2:5379729-5379751 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
927012144 2:18914948-18914970 GAGGGTGAAAGAAGTGCGGAAGG + Intergenic
927101282 2:19789454-19789476 GAGGGTGAAAGCAGGGAGCAGGG + Intergenic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
928337848 2:30413452-30413474 GAGGAGGAAACCAGGGAGGAGGG - Intergenic
928347335 2:30512482-30512504 GAAGGAGATAAAAGGGTGGATGG + Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929546232 2:42856713-42856735 CAGGGTGGTTACAGGGTGGAGGG - Intergenic
929712344 2:44277991-44278013 GAGGATGAAAACAAAGTGGCTGG - Intronic
929878732 2:45818571-45818593 GAGGATGAAAGGAGGGTAGAAGG - Intronic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930339887 2:50098790-50098812 GAGGGTTACTACAGGGTGCATGG + Intronic
931470576 2:62534754-62534776 GAGGGGGAAAAAAGGAAGGAAGG - Intergenic
932020205 2:68076985-68077007 AAGGCTGAAGTCAGGGTGGAGGG + Intronic
932222605 2:70011332-70011354 CAGGTTGAAAACAGGGGGCAGGG + Intergenic
932243341 2:70175336-70175358 GAGGGTGAAACGTGGGAGGAGGG - Intronic
933270351 2:80226637-80226659 GAGGGAAAAAGTAGGGTGGAGGG - Intronic
933449445 2:82428456-82428478 TGGGTTGGAAACAGGGTGGAAGG - Intergenic
933685692 2:85139726-85139748 GAGAGTGAAGACATGGAGGAAGG + Intronic
934935358 2:98461271-98461293 GAGGAGGCAAACAGAGTGGAAGG + Intronic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935803823 2:106727355-106727377 CAGGGTTAGAACAGGCTGGAGGG + Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936286096 2:111182514-111182536 GAGGGAGAGAGCAGGGTGGAAGG - Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937439410 2:121903719-121903741 GAGGGAGGAGACAGGGTGAAAGG - Intergenic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
939202701 2:139058475-139058497 GATGGAGAAAACAGAGTGAAAGG - Intergenic
939825165 2:147006528-147006550 GAAGGAGAGAACAGGGTAGAGGG - Intergenic
940579493 2:155559590-155559612 GAGGGTGAAAGGTAGGTGGAGGG + Intergenic
940738076 2:157476148-157476170 GAGGGTGGAGACGGGGAGGAGGG + Intronic
941133426 2:161683099-161683121 GAGTGTGAATACAGGGTGCATGG + Intronic
941376852 2:164741717-164741739 GAGGGGGCAAACATGCTGGAGGG + Intronic
941429069 2:165389705-165389727 GAGGGTGGAGACGTGGTGGAAGG - Exonic
942200611 2:173567379-173567401 CAGGAGGAAAACATGGTGGAGGG + Intergenic
942401768 2:175610331-175610353 GAGAGTGAGAACTGGGAGGAAGG + Intergenic
942809686 2:179983257-179983279 GAGGGTGAAGGGAGAGTGGAGGG - Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943014736 2:182497265-182497287 GAGTGTGGAAACTAGGTGGAGGG + Intronic
944284013 2:197927378-197927400 GAGGGTGAATACATTGAGGAGGG - Intronic
944555737 2:200886389-200886411 GAGGGAGAAAACAATTTGGAGGG + Intronic
944970305 2:204985189-204985211 GAGGGAAAAAACAGGCAGGAGGG - Intronic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
946789290 2:223284506-223284528 TGGGGTGAAATCAGGGTGGATGG + Intergenic
947706690 2:232282068-232282090 GAGGGTGCAAGCAAGGAGGAAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948648946 2:239426853-239426875 GAGGGTGACAGAAGGATGGAAGG - Intergenic
1168839120 20:897774-897796 AAGGGGGAATGCAGGGTGGAAGG - Intronic
1172216473 20:33239214-33239236 GAGAGTGCAGAAAGGGTGGAAGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173438992 20:43058426-43058448 GAGAGAGAAAAGAGGATGGAAGG + Intronic
1173517643 20:43676255-43676277 GAGGGTGGGAGGAGGGTGGAGGG - Intronic
1174205808 20:48837667-48837689 GAGGGTGAAGATTGGGAGGAGGG + Intergenic
1175735143 20:61380535-61380557 AGGGGTGAAAACAGGTGGGAGGG - Intronic
1175801298 20:61802461-61802483 GACAGTGAAAACAGGGACGATGG - Intronic
1176070798 20:63225265-63225287 GGGGGGGAAAGCAGGCTGGAGGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178929229 21:36803087-36803109 CATGGTGACAACCGGGTGGATGG + Intronic
1179525589 21:41974036-41974058 GAGGAGGAAAACAGGGAAGAAGG - Intergenic
1181119673 22:20657578-20657600 GAGGGAGAAAAGAGAGTGGCAGG + Intergenic
1181776915 22:25166451-25166473 GAGGGTGAAACCAGGGCAGGCGG - Intronic
1182266512 22:29120044-29120066 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266531 22:29120127-29120149 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266570 22:29120295-29120317 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266577 22:29120324-29120346 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266604 22:29120438-29120460 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266609 22:29120467-29120489 GATGATGGAAACAGGGAGGAAGG + Intronic
1182266628 22:29120550-29120572 GACGATGGAAACAGGGAGGAGGG + Intronic
1182473242 22:30561436-30561458 GGGGGTGACAGCAGGGTGGGGGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1182960595 22:34470902-34470924 GAGGGAGAAAATAGAATGGAAGG - Intergenic
1183040718 22:35175782-35175804 GAGGATGAAAATAAAGTGGAGGG - Intergenic
1183096914 22:35557752-35557774 GAGGCTGAGAAGGGGGTGGAGGG + Intergenic
1184002029 22:41682135-41682157 GAGGCTGGACATAGGGTGGACGG + Intronic
949596621 3:5554623-5554645 GAGGGTGAAGGCTGGGAGGAGGG + Intergenic
949943774 3:9174449-9174471 GAGGGAGAAAGCAAGGTGGAGGG + Intronic
950188044 3:10957482-10957504 GAGGTAGAAAACAGGGTCAAAGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950848432 3:16038032-16038054 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
951275724 3:20683250-20683272 GAGGGTGAAATGTGGGAGGAGGG + Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
952853235 3:37746127-37746149 GAAGGTGAAAATACTGTGGAAGG + Intronic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
954415013 3:50389079-50389101 AAGGTTGACAACAGGCTGGAAGG - Intronic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954690591 3:52393537-52393559 GGGCCTGAGAACAGGGTGGAAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955004598 3:54956913-54956935 TAGGTTGAAAACAGGGGTGAAGG + Intronic
955054814 3:55445846-55445868 GAGGGTGGACACTGGCTGGAAGG - Intergenic
955741572 3:62096288-62096310 GAGGGTGAAAGCAGGTCAGAAGG + Intronic
955857305 3:63287030-63287052 GAGGGTGATAAGTGGTTGGAAGG - Intronic
956189305 3:66593377-66593399 GGGTGTGAAAAAAGGGTGGAGGG + Intergenic
956747943 3:72324253-72324275 GAGTGTGGAGACAGGGTGGGAGG - Intergenic
956783700 3:72624788-72624810 AAGGGGGAAAACAGGAAGGAGGG + Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957285898 3:78217517-78217539 GAGGGTAAAAACAGCATGTAAGG - Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
961432296 3:126891671-126891693 GAGGCTGGAACCAGGGTTGAGGG + Intronic
961718349 3:128874612-128874634 AAGTGTGTCAACAGGGTGGAAGG + Intergenic
962057825 3:131891565-131891587 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
962988220 3:140555458-140555480 GACTGTGGAAACTGGGTGGATGG + Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
963946871 3:151155447-151155469 GAGGGTGAAATCAGAGAGGTTGG - Intronic
964287450 3:155134292-155134314 GAGGATTAATAGAGGGTGGAGGG - Intronic
964741463 3:159970579-159970601 GAGGGTAAATAAAGGGTGGTAGG - Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
964828023 3:160850971-160850993 GAGAGAGAAAACAGGGAGGTGGG - Intronic
965033558 3:163405351-163405373 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
966121275 3:176523563-176523585 GACTGTGAAAAGAGGCTGGAAGG + Intergenic
968810427 4:2797322-2797344 GAGGCAGAAACCAGGGTGGGTGG - Intronic
968835226 4:2958879-2958901 GAGGAGGAAAAGAGAGTGGAAGG + Intronic
969295995 4:6270799-6270821 GAGGGTTAAATCTGGGTGGTGGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970262275 4:14239649-14239671 GAGGGAGAAAGCAGAGTGGAAGG + Intergenic
972816400 4:42651348-42651370 GAGGTTGAAAAAAGTTTGGAGGG + Intronic
973575960 4:52289595-52289617 ATGGGTGCAAGCAGGGTGGAAGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
974370269 4:61007591-61007613 GAGGATGAAAAGAGGGAGGTAGG + Intergenic
974881777 4:67767484-67767506 GAGGGTGAAAGGTGGGAGGAAGG - Intergenic
975845474 4:78520350-78520372 GAAGAGGAAAACAGGGAGGATGG - Intronic
976332280 4:83846370-83846392 AAGGATGAACACAGGGTGGCAGG - Intergenic
976665221 4:87583469-87583491 GAGAGAGAAAAGAGGGGGGAAGG - Intergenic
977421817 4:96810444-96810466 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
977655400 4:99515545-99515567 GAGGGTGGAGACTGGGAGGAGGG + Intronic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
979045672 4:115859578-115859600 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
979627603 4:122863335-122863357 AAGGGAGAAAAAAGGATGGAAGG - Intronic
982023819 4:151232242-151232264 GAGGGTAAAAACAGTGGGGATGG - Intronic
982172879 4:152678802-152678824 GAGGTAGAAAACAAAGTGGAAGG - Intronic
983523056 4:168730838-168730860 GAGGGTGAAAAATGGGGGTAAGG - Intronic
984565413 4:181324190-181324212 GAAGGTCAACACAAGGTGGAGGG - Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986105139 5:4652394-4652416 GAAGTTGAAAGCAGGGTTGAAGG + Intergenic
986477222 5:8147522-8147544 GAGGATGAGAATAGGGTGGGTGG + Intergenic
986520214 5:8607638-8607660 GAGGCTGATGACAAGGTGGAAGG + Intergenic
987950027 5:24662744-24662766 GAGGGTGAAAGAAGGGTGAGGGG + Intergenic
989455946 5:41644509-41644531 GTGGGTGAAAAGTGGGAGGAGGG + Intergenic
990630066 5:57659027-57659049 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991365017 5:65859450-65859472 GAGGAGGAAAGCAGGCTGGAAGG + Intronic
994082152 5:95718899-95718921 GATGATGGAAACAGGGTAGAAGG + Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996461458 5:123748560-123748582 GAGAGAGAAAACATGGTGGGAGG - Intergenic
997646960 5:135488210-135488232 GAGGGTAGAAACTGGGTGAAAGG + Intergenic
997652798 5:135535034-135535056 GAAGGAGAAAACAGGGTCGCCGG + Exonic
998078847 5:139258137-139258159 GAGGGAGAAAACAGGGAAGGAGG + Intronic
998912016 5:146970071-146970093 GAGGATGTAAAGAGGGTGGATGG - Intronic
999252130 5:150188994-150189016 GAGCTTGAAAAAAGGTTGGAGGG - Intergenic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
1000395778 5:160773339-160773361 GAGCCTGAAAACAGGCTGGATGG + Intronic
1001067232 5:168546046-168546068 GAGGGTGGAAGCTGGGAGGAGGG - Intergenic
1001183840 5:169547863-169547885 GAGGGTGATAGGAGGGTAGAAGG - Intergenic
1001972443 5:175967658-175967680 GAAGGTGAGGAGAGGGTGGATGG - Intronic
1001977911 5:176015464-176015486 GAAGGAGAAAAGAGGGAGGAAGG - Intronic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002239509 5:177828298-177828320 GAAGGAGAAAAGAGGGAGGAAGG + Intergenic
1002244996 5:177876122-177876144 GAAGGTGAGGAGAGGGTGGATGG + Intergenic
1003060414 6:2858281-2858303 GAAGGGAGAAACAGGGTGGAAGG - Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003479184 6:6515750-6515772 GAGGTAGATAACAGGGTGGACGG - Intergenic
1004209208 6:13620779-13620801 GAGGTTTAAAAGACGGTGGATGG + Exonic
1006070529 6:31495005-31495027 GAGGGAGAAAACATAGTTGATGG + Intronic
1006147957 6:31970519-31970541 GAGGGTGAAGGCAGAATGGAGGG - Intronic
1006432740 6:34007812-34007834 GAGGAGGAAAAGGGGGTGGAGGG + Intergenic
1006602093 6:35233013-35233035 GGGGGTGAAAACATAGAGGAAGG + Intronic
1007465072 6:42046043-42046065 GAGGGTGGGAACTGGGTGGAGGG - Intronic
1008156561 6:48022220-48022242 GAGGAGGAAAACAGGGAGAAAGG - Intronic
1010865405 6:80970603-80970625 GATGATGAAAAGAGAGTGGAGGG + Intergenic
1010874176 6:81080783-81080805 GAGGTTCAAAACAGAGTTGAGGG - Intergenic
1011754307 6:90483473-90483495 GAGGGTGAAAGTGGGGAGGAAGG - Intergenic
1012274706 6:97259013-97259035 GTGGGTGAAAATGGAGTGGAAGG - Intronic
1012953877 6:105547884-105547906 GAGGTAGAAAAAAGGGAGGAAGG + Intergenic
1013542797 6:111127786-111127808 AAGGGTGGAAACAGAGTAGAGGG + Intronic
1013613861 6:111822972-111822994 CAGGGTAAAAACGGGGTGTAAGG + Intronic
1013682110 6:112535835-112535857 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1015062727 6:128986915-128986937 GAGGAAGAAAACAGGATGAATGG - Intronic
1015189835 6:130460602-130460624 GTGGGTGAGAAGAGAGTGGATGG - Intergenic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1017755461 6:157525646-157525668 GAGTGTGAAAACCAGGAGGAGGG + Intronic
1017889508 6:158627086-158627108 GAGGGTGAAAACGAGGGTGAGGG - Intronic
1018271202 6:162079686-162079708 GAGGGTGACAATAAGGTGGGTGG - Intronic
1018368322 6:163144948-163144970 GATGGGGAAAAGAGGGTGGGAGG - Intronic
1018699728 6:166416790-166416812 GATGGTGAAGGCATGGTGGAGGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019587771 7:1814308-1814330 GATGGGGAAAGCAGGGTGGTGGG + Intergenic
1019795112 7:3043408-3043430 GAGGGAGAAAAAGGGTTGGAAGG + Intronic
1020002042 7:4761714-4761736 GGGAAAGAAAACAGGGTGGAAGG + Intronic
1020658406 7:10954250-10954272 GAGTGTGGTATCAGGGTGGAGGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023721980 7:43105452-43105474 GAGTATGAATACAGAGTGGATGG - Intergenic
1023743321 7:43300478-43300500 GAGGGTGGAAGAAGGGTGGAAGG + Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024377398 7:48655477-48655499 GAGAGTGGAGACAGGGTGGAAGG + Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024948505 7:54834775-54834797 GAGGGTGGGAGCAGGGTGGGTGG - Intergenic
1025610952 7:63075242-63075264 GAGCTTAAAAACATGGTGGAAGG + Intergenic
1025723050 7:64033797-64033819 GAGGGAGAAAACTAGCTGGAGGG - Intronic
1026315215 7:69221761-69221783 CACGGTGAAATCAGGGTGGCGGG - Intergenic
1026441921 7:70452512-70452534 GCAGGAGGAAACAGGGTGGAAGG - Intronic
1028133996 7:87207664-87207686 GAGGGAGAAGGCAGGGTAGAGGG + Intronic
1028510461 7:91619941-91619963 AAGGGTAAAAACAGAGTGGATGG - Intergenic
1028565757 7:92228733-92228755 GAGGGTGGAAGCTGGGAGGAGGG - Intronic
1030016809 7:105231066-105231088 GAGGGTGAAAATAGGGAGAGGGG - Intronic
1030305727 7:108017402-108017424 GAGAGAAGAAACAGGGTGGAGGG + Intergenic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030366649 7:108654383-108654405 GAGGGTGTAAACATGGAGGTTGG + Intergenic
1030950613 7:115786842-115786864 GAGGGTGGAAGATGGGTGGAGGG - Intergenic
1032169760 7:129574893-129574915 AAGAGTGAAAACATGGTGGAGGG - Intergenic
1033735916 7:144221657-144221679 GAGGTTGAAAACAGGGAAGACGG - Intergenic
1033747135 7:144329295-144329317 GAGGTTGAAAACAGGGAAGACGG + Intergenic
1033885600 7:145941170-145941192 GAGGGGAACAGCAGGGTGGAGGG - Intergenic
1035454673 7:159000192-159000214 GAGGGTGAAAGAACGGGGGACGG + Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1035674938 8:1449852-1449874 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674949 8:1449899-1449921 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674960 8:1449946-1449968 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674970 8:1449993-1450015 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674980 8:1450040-1450062 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674990 8:1450092-1450114 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675001 8:1450139-1450161 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675025 8:1450234-1450256 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675036 8:1450281-1450303 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675066 8:1450422-1450444 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1037617740 8:20534666-20534688 GAGGGTGAAAGGTGGGAGGAGGG - Intergenic
1038020031 8:23544947-23544969 GAGGGTGGAAACAGGAGGAAGGG + Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038540903 8:28389387-28389409 GTGGGAGAAAGCAGGGTGAAGGG - Intronic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1038750556 8:30291542-30291564 GAGGGTGAAAATAGCCTGGCAGG + Intergenic
1038920342 8:32076568-32076590 GAGGGTGGAAAGTGGGTGGAGGG + Intronic
1039547822 8:38422289-38422311 GAAGGTGAACACAGGAGGGATGG + Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1042703990 8:71647396-71647418 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1044271296 8:90247244-90247266 GAGTGTGAAAACAGGGAAGTTGG - Intergenic
1044342266 8:91060033-91060055 AAGGGGGAAAGCAGGCTGGAGGG + Intergenic
1044462240 8:92458827-92458849 GAGGGTAAAAGGTGGGTGGATGG + Intergenic
1044539378 8:93392511-93392533 GAGGGAGAAAACAGGGGTGATGG - Intergenic
1044672021 8:94691916-94691938 GAGGTAGAAAACAGAGTGGGTGG + Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1047162673 8:122398242-122398264 GAAGGTGAAACCAGGGGGCATGG - Intergenic
1047827043 8:128588113-128588135 GGGGGTGGAAGGAGGGTGGATGG - Intergenic
1049293290 8:141815414-141815436 GAGATTGAAAACATGGTGGCCGG - Intergenic
1049474923 8:142792713-142792735 GAGGATGGATACAGGATGGATGG - Intergenic
1049974110 9:845639-845661 GAGGCTGAAGGCAGGGAGGAAGG - Intronic
1050113949 9:2243591-2243613 AAGGTGGGAAACAGGGTGGAAGG + Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050342067 9:4650376-4650398 AAGGGTGAAAAGTGTGTGGATGG - Intronic
1050649856 9:7764393-7764415 AAGGGGGAAAGCAGGCTGGAAGG - Intergenic
1050838998 9:10122796-10122818 GATGGTTAAGTCAGGGTGGAAGG - Intronic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1052570853 9:30221142-30221164 GATGATGGAAACAGGGTAGAAGG + Intergenic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1055304807 9:74918405-74918427 GAGGGTGAAGAGAGGCTGGTTGG + Intergenic
1055659213 9:78485352-78485374 CAGGGAGAAAACAGGAGGGAAGG - Intergenic
1056075171 9:83030917-83030939 GAGAGTGAAAAGAGGGAGAAAGG - Intronic
1056461058 9:86810335-86810357 GAGGATGAAGACAGTGTGTAAGG + Intergenic
1056719949 9:89063028-89063050 CATGGTGAAAGCAGGGTTGAGGG + Intronic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058597676 9:106632206-106632228 GAGGGTGCAATCAGGGAGGAAGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059533038 9:115055389-115055411 GAGGGTGAAAAGTGGGTAGCGGG + Intronic
1060808482 9:126594432-126594454 GAGGAAGGAAACAAGGTGGAGGG + Intergenic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1062050479 9:134444337-134444359 GAGGGGGAAAGCAGGAGGGAAGG - Intergenic
1185965024 X:4590542-4590564 GAGGGTGGAAGAAGGGAGGAAGG + Intergenic
1187472160 X:19579150-19579172 GATGGTGAAGACACGCTGGAAGG + Intronic
1187806527 X:23127263-23127285 GATTATGAAAACAGGGTTGAAGG - Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189319371 X:40078419-40078441 AAGGGTGCAAGAAGGGTGGAAGG + Intronic
1189689168 X:43597822-43597844 TAGGGTACAAGCAGGGTGGAAGG + Intergenic
1189701602 X:43719305-43719327 GGGGGTGGAGACAGGATGGAAGG + Intronic
1189827099 X:44930951-44930973 GAGGGTCAAAACATGAAGGAGGG - Intronic
1189871656 X:45390595-45390617 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
1189890630 X:45598572-45598594 GAGAGTGAAGACAGTGTAGATGG + Intergenic
1190384420 X:49871137-49871159 GAAGGAGGAAATAGGGTGGAGGG - Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1191899337 X:66024517-66024539 GAGGATGAAAACAAGTTGTAAGG - Intronic
1192529335 X:71872022-71872044 GAGGGTGAAAAGGGAGAGGAGGG + Intergenic
1194758910 X:97770644-97770666 GAGTGTGAAAACAGGGTTTGGGG + Intergenic
1195928091 X:110046490-110046512 GAGGCTGAAAAAAGGTGGGATGG + Intronic
1196540752 X:116904080-116904102 GAGGTTGAAAAGTGGGAGGAGGG + Intergenic
1196809771 X:119619790-119619812 GTGGGGGAAGACAGGGGGGATGG + Intronic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1198202906 X:134439772-134439794 AAGGGTGAAAACAGTGCAGAAGG - Intergenic
1198885365 X:141329666-141329688 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1199330052 X:146548975-146548997 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1199835209 X:151583058-151583080 GTGGGTGTAAGCAGGGTGGTTGG + Intronic
1200777394 Y:7181598-7181620 GAGGGGGAAGACAGGGTGTTAGG + Intergenic