ID: 1038575404

View in Genome Browser
Species Human (GRCh38)
Location 8:28700514-28700536
Sequence AAGAACTGCACCCCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038575404_1038575406 6 Left 1038575404 8:28700514-28700536 CCTGTCTCTGGGGTGCAGTTCTT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1038575406 8:28700543-28700565 GCAGCCGACCACCCAAGCGCAGG No data
1038575404_1038575413 28 Left 1038575404 8:28700514-28700536 CCTGTCTCTGGGGTGCAGTTCTT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1038575413 8:28700565-28700587 GGCCAGGAGCCAGCTCTACCCGG No data
1038575404_1038575407 7 Left 1038575404 8:28700514-28700536 CCTGTCTCTGGGGTGCAGTTCTT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1038575407 8:28700544-28700566 CAGCCGACCACCCAAGCGCAGGG No data
1038575404_1038575409 12 Left 1038575404 8:28700514-28700536 CCTGTCTCTGGGGTGCAGTTCTT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1038575409 8:28700549-28700571 GACCACCCAAGCGCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038575404 Original CRISPR AAGAACTGCACCCCAGAGAC AGG (reversed) Intronic
904604014 1:31689215-31689237 AAGGCCAGCACCCCAGAGGCAGG + Intronic
906663665 1:47601851-47601873 AAGGACTCCTCCCCAGAGAAAGG + Intergenic
906720308 1:47999115-47999137 AAGAAGGGGACACCAGAGACTGG + Intergenic
906726340 1:48047211-48047233 CAGAACTCCACACCACAGACAGG - Intergenic
910009723 1:82446491-82446513 ATGAACAGCACTCCAGAGGCAGG - Intergenic
911485467 1:98499663-98499685 AGGAACAGAACCCCAGGGACTGG - Intergenic
914846610 1:151287057-151287079 AAGAAGGGCACCCCAGCAACTGG - Exonic
915457218 1:156048770-156048792 AGGAACTGCCCCACAGTGACAGG + Intronic
915871443 1:159563899-159563921 AAGAAAGGCAGCACAGAGACAGG - Intergenic
917734267 1:177906420-177906442 AACAACAGAACCCAAGAGACAGG + Intergenic
920069869 1:203295129-203295151 AAGCACAGCACTCCAGAGCCTGG + Intergenic
920177921 1:204114674-204114696 AAGAACTGCCCTACAGAGCCAGG - Intronic
920388864 1:205586417-205586439 AAGATCAGCAGCCCAGAGAGGGG - Intronic
922235660 1:223720770-223720792 AAAAACTGAGCCACAGAGACGGG + Intronic
922553068 1:226511475-226511497 GAGCACTCCACCCCAGAGATGGG - Intergenic
922947314 1:229527802-229527824 CAGAACTCCACCCCAGAACCAGG - Intronic
1063368001 10:5502883-5502905 AAGAACTGCAGCAGAGGGACAGG + Intergenic
1063614831 10:7592689-7592711 GAGAACTGCACTCCACAGGCAGG + Intronic
1066250655 10:33629750-33629772 AAGAAGTGCGCTCCAGAGTCAGG - Intergenic
1067718889 10:48711566-48711588 AAGGACTGCACCCAAGAGCCAGG + Intronic
1067907907 10:50313167-50313189 AAGAACTGCACAGCAAAGACAGG + Intronic
1068721495 10:60251266-60251288 CAGCAATGCACCCCAGAGAGCGG - Intronic
1069338370 10:67380724-67380746 AAGAAGTGGAGGCCAGAGACTGG + Intronic
1069866436 10:71506560-71506582 TGGAGCTGAACCCCAGAGACTGG + Intronic
1073683942 10:105732455-105732477 TTGAACTGCACCCCAAAAACTGG + Intergenic
1075203946 10:120430705-120430727 ATGACCTGCACCCTAGAGGCAGG + Intergenic
1075258361 10:120943238-120943260 GAAAACTGCAGCCCAGAGAGGGG + Intergenic
1078408253 11:11089912-11089934 AAGAACTGCCAACCAGTGACTGG - Intergenic
1081413730 11:42788796-42788818 AAGAACTCCACCACAGACCCAGG - Intergenic
1081457603 11:43240488-43240510 AAAAACTGCACCACAGACTCTGG + Intergenic
1081763344 11:45592338-45592360 AGGTACTGATCCCCAGAGACAGG - Intergenic
1083699115 11:64462916-64462938 CAGAACTCCACTCCAGAGGCAGG - Intergenic
1085782951 11:79425780-79425802 CAGAAGTGGACCCCAGAGGCAGG - Intronic
1086986829 11:93260348-93260370 AAAAAGTGTACCCTAGAGACAGG + Intergenic
1089248246 11:117137944-117137966 AAGAACTCCATCCCCCAGACAGG - Intergenic
1089258465 11:117206617-117206639 AAGAACTCCATCCCCCAGACAGG + Intronic
1089396008 11:118136615-118136637 AAGAGCTGCACCCTGGAGATGGG - Exonic
1089501307 11:118933019-118933041 AGAAGCTGCAACCCAGAGACAGG - Intronic
1090135629 11:124195735-124195757 ATGAATTGCATCCCAGAGAGTGG - Intergenic
1093898714 12:24605557-24605579 GAGAACAGCACCCCAGATAAGGG + Intergenic
1094242347 12:28242816-28242838 AAGAACAGCACCACACAGAGGGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096345588 12:50843168-50843190 AAGAGAGGCTCCCCAGAGACAGG - Intronic
1097832810 12:64243362-64243384 CAGAACTGCTACCCAGACACTGG - Intergenic
1101838709 12:108312688-108312710 AAGACCTGGACTCCAGAGTCAGG - Intronic
1103387901 12:120548356-120548378 AAGAACTGAACCTCTGAGTCTGG + Intronic
1104530600 12:129566854-129566876 AAGACCTGGACTCCATAGACAGG - Intronic
1104770868 12:131363519-131363541 AAGAACTGCAGCCCAGCGAGCGG - Intergenic
1105855594 13:24369141-24369163 AAGCACAGCACCACAGAGAGGGG + Intergenic
1107516111 13:41131497-41131519 AGAAAATCCACCCCAGAGACTGG - Exonic
1107522048 13:41193243-41193265 AGAAAATCCACCCCAGAGACTGG - Exonic
1111215262 13:85133061-85133083 AAGCACTGCACCACAGAGAGGGG + Intergenic
1113433019 13:110266512-110266534 AAGAACAGCAGCCCAAAGAAAGG + Intronic
1113593218 13:111514903-111514925 CAGACCTGCTCCCCAGAGCCAGG + Intergenic
1115034037 14:28835907-28835929 GCAAACTGGACCCCAGAGACAGG + Intergenic
1115221794 14:31065323-31065345 AAGAACTGCTTCCCGGAGAAGGG - Intronic
1117224923 14:53646741-53646763 AAGAGCTACACCCCAGAAATAGG - Intergenic
1118255502 14:64201776-64201798 CAGAACTGCACCCCATAGCTGGG - Intronic
1118478827 14:66143661-66143683 CAGAACTGCAACCCATAGATTGG + Intergenic
1120176843 14:81303569-81303591 AAGCAATGAACCCCAGAGAGAGG + Intronic
1120376015 14:83708336-83708358 AGGAACATCTCCCCAGAGACGGG - Intergenic
1122427496 14:101620416-101620438 ATGAGCTGGACCCCAGAGCCAGG + Intergenic
1122786158 14:104164173-104164195 AGGACCTGCACCCCAGAGCCGGG - Intronic
1127461359 15:59202244-59202266 AGGAACTGCACCCCTGGGCCAGG - Intronic
1127686551 15:61351217-61351239 AAGAATTGCACCCCTGAGTGGGG - Intergenic
1128514671 15:68334906-68334928 ATGGCCTGCACCCAAGAGACAGG + Intronic
1131072087 15:89472386-89472408 AATCTCTTCACCCCAGAGACTGG - Intronic
1132671938 16:1105678-1105700 CAGAGCTGCCCCCCAGAGGCAGG + Intergenic
1133372725 16:5257581-5257603 AAGAACTCAGCGCCAGAGACAGG - Intergenic
1135251130 16:20901399-20901421 GAGAAATGCCCCCCAAAGACCGG + Intronic
1139901700 16:70333338-70333360 AAGAACAGCTCCCCTGTGACTGG + Intronic
1140433424 16:74924567-74924589 AAGAACTGCACCTCAGATGTTGG - Intronic
1140796665 16:78444824-78444846 AAGAACTGCTCCTCATAGGCCGG - Intronic
1141386421 16:83625909-83625931 AAACACTGCACCCCAAAGTCAGG + Intronic
1141517258 16:84553897-84553919 CAGAGCTGCACCCCAGGGATCGG + Intronic
1144739938 17:17576178-17576200 AAGAGCTTCACCCCACAGTCTGG + Intronic
1145750451 17:27351554-27351576 TATAACTGAACACCAGAGACTGG - Intergenic
1146461854 17:33052415-33052437 AATTACTGCAGCCCAGAGAAAGG - Intronic
1147732022 17:42609953-42609975 AAGGACTGTACGCCAGGGACTGG - Intronic
1148667160 17:49383331-49383353 AAGAACTGCAGTCCAGCCACCGG + Intronic
1149639265 17:58192630-58192652 CAGAACTCCACCCAAGAGGCTGG + Intergenic
1149662220 17:58340023-58340045 GAGGACTGAGCCCCAGAGACTGG - Intergenic
1152541192 17:80976858-80976880 CAGCATTGCAGCCCAGAGACTGG - Intergenic
1157306868 18:46524037-46524059 AAAAACTGAAGCCAAGAGACTGG + Intronic
1159128536 18:64253668-64253690 GAGAATTGCAACCCAGAAACTGG - Intergenic
1162705298 19:12550990-12551012 ACGAACCGCACACCCGAGACGGG + Intronic
1164518130 19:28953908-28953930 AAGAAAACCACCCCAGAGAATGG - Intergenic
1166093644 19:40526147-40526169 AAGAACAGCACCTCACACACAGG - Intronic
1166953770 19:46448086-46448108 AGGAACTGGAGCCCAGAGGCAGG + Intergenic
1168524039 19:57074565-57074587 AAGACTTCCACCCCAGAGGCTGG - Intergenic
926149843 2:10419322-10419344 AAGAACTGCCCCAAAGAGTCTGG + Intronic
927151090 2:20196657-20196679 AGGAACCTCACCCCACAGACAGG - Intergenic
927506990 2:23621151-23621173 GAGAACTGGGCCCCATAGACTGG - Intronic
927655703 2:24943617-24943639 AATAAATGCAGCCCACAGACCGG + Exonic
931760477 2:65412399-65412421 AAGAATTGCACGCCAGATTCTGG + Intronic
932219876 2:69991185-69991207 GAGAGCTGCACCCCACACACGGG + Intergenic
933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG + Intronic
933976497 2:87516125-87516147 GAGAACTGCAGCCTAGAGCCAGG + Intergenic
934780649 2:96967683-96967705 AACACCTGCAGCCCAGTGACAGG - Intronic
935730950 2:106064905-106064927 CAGAACTGCATCCCAGTAACTGG - Intronic
937315858 2:120931800-120931822 GAGATCTGCACCCCAGAGCCTGG - Intronic
937376596 2:121340556-121340578 AAAAACTGCACCCCACACACAGG + Exonic
939530312 2:143351559-143351581 AAGAAATGGACCCAAGAAACTGG - Intronic
941917660 2:170822931-170822953 AAGAACTGCTCTCTGGAGACAGG + Intronic
942706057 2:178773968-178773990 AAGAAGTGCAGCCCAGTGACAGG - Exonic
1168852213 20:984767-984789 AGAAACTGAAGCCCAGAGACAGG - Intronic
1169149447 20:3277732-3277754 AGGCACTGCACCTCAGAAACAGG - Intronic
1170538658 20:17366124-17366146 AAGAACTGGAGCTCAGAGCCAGG + Intronic
1171405305 20:24908919-24908941 TATAACTGGACACCAGAGACTGG - Intergenic
1172697161 20:36830864-36830886 AGGAACTGAAGCCCAGAGAAGGG + Intronic
1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG + Intronic
1177496246 21:21895742-21895764 AAGAAATGCAGCCCTGAGATAGG + Intergenic
1178632501 21:34274675-34274697 AAGAACAAAATCCCAGAGACAGG - Intergenic
1178943622 21:36928051-36928073 TAGATCTGGACCACAGAGACTGG - Intronic
1179096697 21:38322536-38322558 AAGAAATGCACCACAGAGGGTGG + Intergenic
1180353684 22:11822922-11822944 AAAAACTGCACCACAGAGAAGGG - Intergenic
1180722613 22:17920581-17920603 AAGAATTGCAGCTGAGAGACTGG - Intronic
1184582182 22:45425392-45425414 AATGACTGCAGCCCAGAGAGGGG + Intronic
1184928307 22:47660029-47660051 ATTAACTGCACCCCAGAGGGAGG - Intergenic
1185094512 22:48798967-48798989 AGGAGCTGCCCCACAGAGACGGG - Intronic
1185227072 22:49659323-49659345 AAGGCCAGCACCCCAGAGAAGGG + Intergenic
950075912 3:10187041-10187063 AAGAAATGCACTTCAGATACTGG - Intronic
952151909 3:30602574-30602596 AAGAACTGCAAACAAGAGAATGG + Intergenic
953288585 3:41638422-41638444 AAGAAATGCACCCCAAAAAATGG + Intronic
954817365 3:53293223-53293245 AGGCACTGGACCTCAGAGACTGG + Intronic
963964469 3:151350182-151350204 AAGAAGAGCACCACAGAGACAGG + Exonic
969897623 4:10320169-10320191 AAGAACTGCAGGCAAGAGAAGGG - Intergenic
972690182 4:41389502-41389524 AACAACTGCGGCCCACAGACGGG - Intronic
975211167 4:71701523-71701545 AAGAAGGGGAGCCCAGAGACTGG + Intergenic
976377158 4:84358678-84358700 AAGAACTCCTCCTCTGAGACTGG + Intergenic
986071860 5:4293009-4293031 AACAGCTGCAGCTCAGAGACAGG - Intergenic
986929725 5:12802959-12802981 AAGACCTGAACCCAAGAGCCTGG + Intergenic
988683634 5:33506798-33506820 AAGACATACACCCCTGAGACAGG + Intergenic
988715579 5:33824162-33824184 AAGAACTAAATCCCAGATACTGG + Intronic
989163404 5:38412616-38412638 AACAATGGCACCCCAGTGACAGG + Exonic
990423440 5:55660370-55660392 CACCACTGCACCCCAGAGCCTGG + Intronic
991439802 5:66634972-66634994 AGGACCTGCATCCCAGAGGCAGG - Intronic
992387682 5:76301521-76301543 TGGAACTGTACCCCACAGACCGG + Exonic
997581990 5:135023965-135023987 AAGCACTGCCTCCCAGAGGCTGG - Intergenic
999510432 5:152245021-152245043 AAGAAACACACCTCAGAGACTGG + Intergenic
1000007633 5:157202005-157202027 AAGAAGGGCACCACAGATACCGG - Intronic
1002683963 5:180992534-180992556 AATAACTCATCCCCAGAGACAGG + Intronic
1002700914 5:181124343-181124365 CAGCACTGAACCCCAGAGTCTGG - Exonic
1002843766 6:927549-927571 AAGGACTACACCCCTGAGAATGG + Intergenic
1006059864 6:31411796-31411818 AAGAACTGGGCCCCAGAGTGAGG + Intronic
1006313634 6:33278022-33278044 AAGCACGGAACCCCAGAGAGAGG + Exonic
1006643883 6:35503231-35503253 AAGATCTGCACCCCTGGGCCGGG - Intronic
1010353263 6:74901201-74901223 ACTCACTGCACCCCAAAGACTGG - Intergenic
1011165307 6:84439798-84439820 AAGATAAGCATCCCAGAGACTGG - Intergenic
1011463296 6:87628625-87628647 AAGAACTGCAGCCAAGAGAAAGG + Intronic
1016647455 6:146426352-146426374 AAGAGATGCACCCCACTGACAGG + Intronic
1017644872 6:156529809-156529831 AAGATCTGCACTCCAGAGCCTGG + Intergenic
1017723551 6:157261308-157261330 CAGAACTGCCCCTCACAGACTGG + Intergenic
1020334309 7:7050452-7050474 AAGACCTGTACCCCAGTGAGAGG - Intergenic
1022088573 7:27092720-27092742 AAGATGTGCAACCCAGAGATGGG + Intergenic
1023585145 7:41721849-41721871 AAGAACTTAAACCCAAAGACAGG - Intergenic
1024127661 7:46317035-46317057 AAGAACTTGGGCCCAGAGACAGG - Intergenic
1024634271 7:51274511-51274533 AAGAATTGTACCCCACAGAATGG + Intronic
1025252742 7:57362835-57362857 AAGATCTGCATCCCAAGGACAGG + Intergenic
1034047117 7:147941154-147941176 AAGCACTGTGCCCCGGAGACTGG + Intronic
1034917928 7:155056287-155056309 CAGAACCGGACCCCAGAGAACGG - Intergenic
1037127710 8:15370836-15370858 GAGAACTACAAGCCAGAGACGGG - Intergenic
1038439322 8:27560496-27560518 AAGAACAGGAGCCCAGAGAAAGG - Intergenic
1038575404 8:28700514-28700536 AAGAACTGCACCCCAGAGACAGG - Intronic
1042611712 8:70607929-70607951 AAGGCCTGCACCTCAGGGACTGG + Intronic
1044918199 8:97138314-97138336 AAGTACTCCACCCCAGAGCAAGG + Intronic
1050078557 9:1890526-1890548 AAAAACTTCAGCCCACAGACGGG - Intergenic
1051145347 9:14021490-14021512 CAGCACTGCTCCCCAGAGCCGGG - Intergenic
1052489143 9:29140912-29140934 AAATACTGTACCCCAGAAACTGG + Intergenic
1053104898 9:35400959-35400981 ATAAACAGCACCCCTGAGACTGG - Intronic
1058014922 9:100020176-100020198 AAGAATTGTTCCCCTGAGACAGG + Intronic
1058728167 9:107823599-107823621 AAAAAAGGTACCCCAGAGACAGG - Intergenic
1058750565 9:108034921-108034943 AGGAGCTGCATCCCAGAGAAGGG + Intergenic
1058864316 9:109147383-109147405 AAGAACTGCAGTCCTGAGATGGG + Intronic
1058891493 9:109365106-109365128 AGGAACAGCTCCCCAGAGAAAGG - Intergenic
1060584790 9:124779228-124779250 AGAAACTGAAGCCCAGAGACAGG - Intronic
1061028336 9:128064987-128065009 AAGAAAGGCACCCCAGAGGCTGG + Intronic
1061477052 9:130874994-130875016 ATGGACTGCACCCGAGAGCCTGG + Exonic
1062590356 9:137271847-137271869 CAGAGCTGCAGCCCAGGGACAGG - Intronic
1186614160 X:11169402-11169424 CAGCACTGCACCCCAGAGGGTGG + Intronic
1187206072 X:17182716-17182738 AAGACATGCAGCCCAGTGACTGG + Intergenic
1187672980 X:21686928-21686950 AAGCACGGCACCACAGAGAGGGG - Intergenic
1189177263 X:38970339-38970361 AAGAACTTCAGCCCAGATATAGG - Intergenic
1189499384 X:41541353-41541375 AAGAAATGCACTGCAGAGCCAGG - Intronic
1190333307 X:49248664-49248686 AAGAACTGCACCAGAGTGTCCGG + Exonic
1192039751 X:67606163-67606185 AAGAAAAGCACCCCAGACAGAGG + Intronic
1193295583 X:79828246-79828268 AGGATCTGCACCCAGGAGACAGG + Intergenic
1194089616 X:89568523-89568545 AAGAACAGCAGCCCAGAAACAGG + Intergenic
1195104167 X:101587068-101587090 AAGAGCTGCACCTCAGAGTCAGG - Intergenic
1197599022 X:128505256-128505278 AAGAACTGCAACTGAGAAACAGG + Intergenic
1197610652 X:128634629-128634651 CAGAACTGCATCCCAGTTACGGG + Intergenic
1198811472 X:140540428-140540450 AAGGACTGACCCCCAGAGAGAGG + Intergenic
1200442271 Y:3224576-3224598 AAGAACAGCAGCCCAGAAACAGG + Intergenic