ID: 1038575665

View in Genome Browser
Species Human (GRCh38)
Location 8:28701699-28701721
Sequence CCGCGCCCGGAAGGGCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038575658_1038575665 -8 Left 1038575658 8:28701684-28701706 CCCGAGGAGCGGGGGCCGCGCCC 0: 1
1: 0
2: 0
3: 23
4: 267
Right 1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1038575651_1038575665 19 Left 1038575651 8:28701657-28701679 CCGGTAGGACTGCTGGCCGCGCG 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1038575653_1038575665 3 Left 1038575653 8:28701673-28701695 CCGCGCGTGAGCCCGAGGAGCGG 0: 1
1: 0
2: 1
3: 10
4: 71
Right 1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1038575659_1038575665 -9 Left 1038575659 8:28701685-28701707 CCGAGGAGCGGGGGCCGCGCCCG 0: 1
1: 0
2: 2
3: 27
4: 251
Right 1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038575665 Original CRISPR CCGCGCCCGGAAGGGCTCAT GGG Intronic
1065533665 10:26697856-26697878 GCGCGCCCGGCGGGGCTCAGAGG + Intronic
1067015696 10:42755168-42755190 CGGGGCCCGGAAGGGCTCCCCGG + Intergenic
1081868923 11:46374531-46374553 CAGCACCCGGCAGGGCTCCTGGG - Intronic
1088578923 11:111298508-111298530 CAGCGCCTGGGAGGGCTCCTGGG - Intronic
1091727108 12:2853938-2853960 CCGCCACAGGAAGGCCTCATGGG - Intronic
1103822882 12:123712532-123712554 CCGCGCCCGGAGGGGCTCGATGG - Exonic
1112044145 13:95578852-95578874 CTGCTCCAGGAAGGGCTAATGGG + Exonic
1112638533 13:101245163-101245185 CTGCACCAAGAAGGGCTCATTGG + Intronic
1118727810 14:68642213-68642235 CCAGGCCCAGATGGGCTCATTGG - Intronic
1123021105 14:105398386-105398408 CGACGCCCGGAAGGGCCCGTGGG + Intergenic
1133311103 16:4847396-4847418 CCGCGCCCGCCGGGGATCATTGG + Intronic
1139408496 16:66739189-66739211 CAGAGCCTGGAAGGGCTCACAGG + Intronic
1142688559 17:1591583-1591605 CGGCCCCGGGAAGGGCTCAAGGG + Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1150288161 17:63965775-63965797 CCGCGCCCGGCAGGCAGCATTGG + Intronic
1150388682 17:64778948-64778970 CAGCGGCCGGTAGCGCTCATTGG + Intergenic
1151540134 17:74760565-74760587 GCGCGCCCAGGAGGGCTTATGGG - Intronic
1152854969 17:82659488-82659510 CCGGGCCCTCCAGGGCTCATGGG - Intronic
1152875227 17:82782634-82782656 CCGCGCCTGGAAGGACACTTTGG + Intronic
1163480877 19:17555644-17555666 CCGCGCCTTAAAGGGGTCATAGG - Exonic
1163743790 19:19033194-19033216 CCGCGTCCACAAAGGCTCATTGG - Intronic
1166294898 19:41884158-41884180 CCGCGCCCGGAGGTGCAGATGGG - Intronic
1167506398 19:49873227-49873249 CCGGGCCCGGAAGCGCTCAGCGG + Exonic
925183227 2:1830489-1830511 CGGCACCCCGAAGGGCTCACAGG + Intronic
925183240 2:1830534-1830556 CGGCACCCGGAAGGGCTCACAGG + Intronic
925183254 2:1830579-1830601 CGGCACCTGGAAGGGCTCACAGG + Intronic
926580926 2:14632643-14632665 CCGCCCCAGGACGCGCTCATTGG - Intergenic
931839982 2:66138125-66138147 CCACCCACGGAAGGGCTGATTGG + Intergenic
948368927 2:237475314-237475336 CCGCGCCCAGAATGGCTCCGAGG + Intergenic
949017306 2:241720655-241720677 CCGGGCGCGGAAGGGCTCGCTGG + Intronic
1175691568 20:61069173-61069195 CCGCGCCCTCAAGGCCTCCTGGG + Intergenic
1180144789 21:45913022-45913044 CCCTGCCAGGAACGGCTCATGGG + Intronic
966592878 3:181700915-181700937 CCCCGCCCGCAATGGCTAATTGG - Intergenic
967694456 3:192515011-192515033 CCGCCTCCGGAAGGTCTCAAGGG - Intronic
985634779 5:1030667-1030689 CCTCGCCGGGCTGGGCTCATGGG + Intronic
1008027406 6:46653373-46653395 TCGCGCCCGGCAGTGCGCATCGG + Intronic
1012791072 6:103696585-103696607 CAGCACCTGGAAGGGCCCATGGG - Intergenic
1022456327 7:30561550-30561572 CCACTCCCGGAAGGGCACAGAGG - Intergenic
1024094362 7:45972530-45972552 CTGGGCCCTGAAGGGCACATGGG + Intergenic
1028391326 7:90320974-90320996 CCGCGCCGGGACGCGCTCCTCGG - Intergenic
1038575665 8:28701699-28701721 CCGCGCCCGGAAGGGCTCATGGG + Intronic
1053355481 9:37442022-37442044 CTGCGCATGGAAGAGCTCATGGG + Exonic
1062212888 9:135374088-135374110 CAGCGCCTGGAAGGGCTTGTAGG - Intergenic
1203760871 EBV:12622-12644 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203761800 EBV:15694-15716 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203762729 EBV:18766-18788 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203763658 EBV:21838-21860 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203764587 EBV:24910-24932 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203765516 EBV:27982-28004 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203766445 EBV:31054-31076 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1203767374 EBV:34126-34148 CCGGGCCCGGAGGGTCTCAGAGG - Intergenic
1186247580 X:7631269-7631291 CCCAGCCCTGAAGGGCTCCTGGG + Intergenic
1186421723 X:9432136-9432158 CCGCGCCCGGCTGGGCTTTTGGG + Intergenic
1200073387 X:153539717-153539739 GAGCGCCCGGGAGGGCTCCTCGG + Intronic