ID: 1038577461

View in Genome Browser
Species Human (GRCh38)
Location 8:28717348-28717370
Sequence TCGCCCTCATCATTACCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038577457_1038577461 6 Left 1038577457 8:28717319-28717341 CCGCTTGGAATTGCTGAAGCTCT 0: 1
1: 0
2: 1
3: 6
4: 162
Right 1038577461 8:28717348-28717370 TCGCCCTCATCATTACCCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038577461 Original CRISPR TCGCCCTCATCATTACCCCC GGG Exonic
906455197 1:45989739-45989761 TGTCCCTCATCATTTCCCGCTGG + Intronic
923274704 1:232386103-232386125 TGGCCCTCATCAGAACCCTCAGG + Intergenic
1067027610 10:42858158-42858180 TGGCCCTCAGCATCACACCCAGG - Intergenic
1069288728 10:66749372-66749394 TCTCCCTCTTCACTATCCCCTGG + Intronic
1071564476 10:86664730-86664752 CCTCCCTCAGCATTCCCCCCGGG + Intronic
1081677802 11:44981062-44981084 TCGCCCTCACCAGCTCCCCCAGG - Intergenic
1083261314 11:61524532-61524554 TCACACTCATCTATACCCCCAGG - Exonic
1084268890 11:68018819-68018841 TGGTCCTCATCATTGCGCCCTGG + Exonic
1089847044 11:121466553-121466575 TTGCCCCCATCCTCACCCCCAGG - Intronic
1091590828 12:1842182-1842204 ACGCCCTGATCATTCCCACCAGG - Intronic
1095601157 12:44014315-44014337 TCCCCCTCATCCTAACCCCAAGG - Intronic
1101295671 12:103421173-103421195 TCTCCCTTGTCATTAGCCCCTGG - Intronic
1102579976 12:113880059-113880081 TGGCCTTCATCACCACCCCCGGG - Intronic
1102883977 12:116508106-116508128 TCGCTCTCATTATTACGCACTGG + Intergenic
1109784158 13:67152996-67153018 TAGCCCTCATCACTCCCACCTGG + Intronic
1113573761 13:111380297-111380319 TAGCCCTCATGACTACCCTCAGG + Intergenic
1114211965 14:20623262-20623284 TCGCCCTCAACCTGACCCGCTGG + Intergenic
1116550789 14:46235095-46235117 TCTCCCTCTGCATTACCCCTCGG + Intergenic
1117011578 14:51475985-51476007 TTGCCCTCATCATTTGCCCCCGG + Intergenic
1122662229 14:103304124-103304146 TCACCATCATCATTAGCCTCTGG - Intergenic
1122804663 14:104250351-104250373 CCACCCTCACCATCACCCCCCGG - Intergenic
1123011921 14:105353344-105353366 GCGCCCTCATCACTGTCCCCTGG + Intronic
1123427264 15:20182992-20183014 TGGCCCTCAGCATCACACCCAGG - Intergenic
1123536501 15:21189542-21189564 TGGCCCTCAGCATCACACCCAGG - Intergenic
1132990001 16:2787471-2787493 TCACCCTCATCCTCACCCACTGG + Intronic
1134154777 16:11834080-11834102 TCGCCCTCCTCTTGGCCCCCGGG + Exonic
1136857028 16:33666820-33666842 TGGCCCTCAGCATCACACCCAGG + Intergenic
1137826926 16:51505944-51505966 TCTCCCTCTTCAGTAGCCCCTGG + Intergenic
1203118603 16_KI270728v1_random:1515295-1515317 TGGCCCTCAGCATCACACCCAGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1153952473 18:10068990-10069012 TCACCCTCCTCATTCCCCCTTGG + Intergenic
1154147839 18:11880787-11880809 TCACCCTTATCATTGCCCCCAGG - Intronic
1156565712 18:38187554-38187576 TCTCTCTCTTCATTACCACCAGG - Intergenic
1156898344 18:42272240-42272262 TGGCCCTCAGCATTTCCCACTGG - Intergenic
1163442404 19:17328634-17328656 TCGTCCTCCTCCTTGCCCCCTGG + Exonic
1163509288 19:17725732-17725754 ACACCCTCATCCTTTCCCCCAGG - Intronic
1167063471 19:47166362-47166384 TCGCCTTCTTCATAACCACCTGG - Intronic
926599817 2:14830388-14830410 TAGCACTCATGATTAACCCCTGG + Intergenic
928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG + Intronic
929483062 2:42330193-42330215 TCGCCCTCGTCCTAACACCCTGG + Exonic
936430131 2:112455671-112455693 TCATCTTCGTCATTACCCCCGGG - Intergenic
1169652658 20:7886920-7886942 TCCCCCTCATCTTTGGCCCCAGG + Intronic
966823907 3:183947396-183947418 TCGCCCTCATCACCACCACGGGG - Exonic
967194763 3:187016732-187016754 TGGCCCACATCATTGCCTCCTGG - Intronic
969431719 4:7159010-7159032 TCCCCCTCATCCTCACCACCCGG - Intergenic
975170716 4:71229182-71229204 TCTCACTCAGCATAACCCCCTGG + Intronic
975373884 4:73620225-73620247 TTGCCCTCAACATGACCCCAGGG + Intronic
986465200 5:8014097-8014119 ACAACATCATCATTACCCCCAGG + Intergenic
997811984 5:136979436-136979458 TAGCCCTCCTCATTACACCGAGG + Exonic
1002529083 5:179833163-179833185 GCGCCCTCAACATTCCCACCCGG - Exonic
1011519497 6:88189351-88189373 TCTCCCTCCTCACTAACCCCTGG + Intergenic
1016286467 6:142478907-142478929 TCACTCTCATCCTTAGCCCCTGG + Intergenic
1018240787 6:161772107-161772129 CCGCCATCATCATCACCCACAGG - Intronic
1026960677 7:74405418-74405440 TCGCCCTCATGAGTGCCACCTGG + Exonic
1035488643 7:159252787-159252809 TTGCCATCATCCTGACCCCCAGG + Intergenic
1038577461 8:28717348-28717370 TCGCCCTCATCATTACCCCCGGG + Exonic
1038925350 8:32133140-32133162 TCTCCAACATCATTACCCCAGGG + Intronic
1045911023 8:107410047-107410069 TGGCCCTGATTATTTCCCCCTGG - Intronic
1053131481 9:35618097-35618119 TCCCCATCATCATCAGCCCCTGG + Exonic
1053534588 9:38913204-38913226 TTGCCCTCTGCATAACCCCCAGG + Intergenic
1054206807 9:62137624-62137646 TTGCCCTCTGCATAACCCCCAGG + Intergenic
1054631545 9:67450723-67450745 TTGCCCTCTGCATAACCCCCAGG - Intergenic
1055422812 9:76161906-76161928 TCTCCCTCATCAAGACCACCTGG + Intronic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1057390838 9:94640217-94640239 CCGCCCGCATCCTGACCCCCTGG + Exonic
1062435883 9:136546390-136546412 TCGCCCTCCCCATTCCGCCCCGG - Intergenic
1185666222 X:1767385-1767407 TCACCCTCCTCCTTACCTCCTGG - Intergenic