ID: 1038577742

View in Genome Browser
Species Human (GRCh38)
Location 8:28719488-28719510
Sequence CACTTTGCACAGAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038577742 Original CRISPR CACTTTGCACAGAAGGAAGT AGG (reversed) Intronic
901636582 1:10673266-10673288 CCCATTGGACAGAAGGACGTTGG - Intronic
901690884 1:10972657-10972679 CATTTTGCAGAAAAGGAAATGGG - Intronic
903298593 1:22362057-22362079 GTATTTGCAGAGAAGGAAGTAGG + Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903976484 1:27153754-27153776 CACTGTGCACAGAAGAGAGCAGG - Intronic
904210838 1:28886110-28886132 CACTTTGCAGAGGAGGAAACTGG + Intergenic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
907481929 1:54750899-54750921 TACTTTGCACAGAAGGTAGGTGG - Intergenic
908623455 1:66012543-66012565 CAAACGGCACAGAAGGAAGTGGG - Intronic
913046924 1:115081641-115081663 CACTTTGCAGATGAGGAAGCTGG - Intronic
913233826 1:116763665-116763687 CACTTTACAAAGAAGGAAACAGG + Intronic
915837256 1:159187834-159187856 CCATGTGCACAGAAGGTAGTAGG + Intronic
915990504 1:160511516-160511538 CACATTCAACAGAATGAAGTTGG + Intronic
916214983 1:162386443-162386465 CTCTGTCCACATAAGGAAGTTGG + Intronic
916498161 1:165364098-165364120 CTCTGTGCACAGAAGGAAATGGG + Intergenic
917237469 1:172909781-172909803 CCCTTTGCACAGATGTATGTGGG - Intergenic
918748495 1:188239357-188239379 CATTTTACTGAGAAGGAAGTAGG - Intergenic
918849273 1:189664480-189664502 TACTTTGCTCACAAGAAAGTTGG + Intergenic
920093344 1:203469996-203470018 CAATTTGCACAGAGGGATTTAGG + Intergenic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
920677257 1:208046876-208046898 CACTTTGCTCAGTATGTAGTAGG + Intronic
921356718 1:214291412-214291434 CACTTTCCACTGAAGGGGGTTGG + Intronic
921814411 1:219547715-219547737 CACTTAGTAAAGAAGGAGGTTGG - Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922128876 1:222756985-222757007 CAATTTGAAGAGAAAGAAGTAGG - Intergenic
922245659 1:223794990-223795012 CAGTAAGCACGGAAGGAAGTAGG - Intronic
922890526 1:229058414-229058436 CTCCTTGCACAGCAGGGAGTGGG - Intergenic
924617264 1:245622658-245622680 TACTCTGCACAGAAGGAAAATGG - Intronic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1064123203 10:12637378-12637400 CAACTCTCACAGAAGGAAGTAGG + Intronic
1065865211 10:29909117-29909139 CATTTTGCACAGGAGGAAATGGG - Intergenic
1067290220 10:44934683-44934705 CCGCTTGCTCAGAAGGAAGTAGG - Exonic
1067574261 10:47398383-47398405 CACATTGCAGAAATGGAAGTGGG - Intergenic
1067710948 10:48650854-48650876 CACTTTCCACAGGAGAAAATAGG - Intronic
1069232877 10:66033859-66033881 CATATTGCAGGGAAGGAAGTAGG - Intronic
1070659752 10:78296072-78296094 CCCTTTGCACAGAAGCCAGGGGG + Intergenic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1070713390 10:78699949-78699971 CTCTTTGGGGAGAAGGAAGTTGG - Intergenic
1070772188 10:79088926-79088948 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1071727316 10:88212313-88212335 CACCTTGCACAAGATGAAGTAGG - Intergenic
1074010654 10:109475723-109475745 CACCTTGCACAGAATGACCTGGG + Intergenic
1074210479 10:111328727-111328749 CACCTTGTACAGTAGGAATTTGG - Intergenic
1074569355 10:114610636-114610658 CACTTGCCACAGCAGGAAATGGG - Intronic
1075397458 10:122137927-122137949 GACTTTGGACAGAAGGAGGTGGG + Intronic
1075663941 10:124217596-124217618 CACTTTGTAAAGATGGAAGCTGG + Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076252657 10:128996246-128996268 CACTCTGCAGAGAAGGAAACTGG + Intergenic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1077735552 11:4786848-4786870 AACTGTGCTCAGAAGGAAGAAGG - Intronic
1078948192 11:16095464-16095486 CAGTTTTCTCAGAATGAAGTAGG - Intronic
1079765139 11:24382649-24382671 TACTTTACACAGAAGGAGTTGGG - Intergenic
1080400635 11:31932090-31932112 CATTTTGCAGATAAGGAAATTGG - Intronic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1082938124 11:58675480-58675502 CACTTTGCGCAGAACGGAGGAGG - Intronic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1084463428 11:69308824-69308846 CACTGTGCACCTAAGGCAGTGGG - Intronic
1084698047 11:70768099-70768121 CACTTTACAGAGAAGGAAACAGG - Intronic
1084940362 11:72609370-72609392 CACTTTCCCCAGAAGGAAGGTGG + Intronic
1085362770 11:75906720-75906742 CACTTTTAAAAGAATGAAGTTGG - Intronic
1086074731 11:82838009-82838031 TACTTGGAACAGAATGAAGTGGG + Intronic
1086240516 11:84684665-84684687 CACTTTACAGAGGAGAAAGTAGG - Intronic
1086846084 11:91751363-91751385 CATTTTTGAGAGAAGGAAGTGGG - Intergenic
1088833270 11:113556271-113556293 CACTTTGCATATAAGGAAATGGG - Intergenic
1089269922 11:117295065-117295087 CACTATACAGAGAAGGAATTAGG - Intronic
1089390757 11:118100017-118100039 AACTTTTCACAGCAAGAAGTAGG + Intronic
1089932622 11:122329311-122329333 TACTTTGCAAAGAGGGAAGAGGG + Intergenic
1090422267 11:126583649-126583671 CATTTTACAAAGAAGGAAGCAGG - Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091104087 11:132902193-132902215 CAGTTTGCAATGAAGAAAGTTGG - Intronic
1092174354 12:6392850-6392872 TACTTTTCAAAAAAGGAAGTTGG - Intergenic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1093964706 12:25312137-25312159 CACTTTACAGCTAAGGAAGTGGG + Intergenic
1096254875 12:50056854-50056876 GAATTTGGACAGAAGGAAGGAGG - Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1099642106 12:85303670-85303692 CACTGTGTAAAAAAGGAAGTTGG - Intergenic
1099813965 12:87621525-87621547 CAATTTATACAGACGGAAGTTGG - Intergenic
1100147930 12:91699983-91700005 TACTTTGAACTGAAGGAGGTTGG - Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1101694528 12:107112580-107112602 CAATTGCCTCAGAAGGAAGTAGG + Intergenic
1102897589 12:116611078-116611100 CACTTTACAAGTAAGGAAGTAGG + Intergenic
1103334977 12:120182582-120182604 CACTTTGCAAATGAGGAAATGGG + Intronic
1103600326 12:122050650-122050672 CATTTTACAAACAAGGAAGTAGG - Intronic
1104067096 12:125315096-125315118 GCTTATGCACAGAAGGAAGTAGG + Intronic
1104097756 12:125574204-125574226 CACTTTACAGAGAAGAATGTAGG - Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1105688510 13:22811460-22811482 CACGTTGCAAAGATGAAAGTAGG - Intergenic
1105775313 13:23654195-23654217 AACATTGCATAGTAGGAAGTTGG + Intronic
1106181415 13:27372652-27372674 CACATCGCACAGAAGTAAGCTGG - Intergenic
1107394104 13:39997200-39997222 TACATGCCACAGAAGGAAGTGGG + Intergenic
1108771136 13:53701251-53701273 CACATTGAAAAGAATGAAGTTGG + Intergenic
1109360255 13:61285989-61286011 CACTTTGAACTGAAGGCACTTGG - Intergenic
1110297845 13:73889452-73889474 CACTTTGCACATCAAGAAATGGG + Intronic
1110488129 13:76070291-76070313 CATTTTGCACAGGAGGGAGTGGG - Intergenic
1110708576 13:78624814-78624836 CAATTGCCACAGAAGCAAGTAGG - Intronic
1111878621 13:93927277-93927299 ATCTTTGCACAGAAGGTATTTGG - Intronic
1112246649 13:97741280-97741302 CATTTTACACAGAAAGATGTAGG - Intergenic
1113473010 13:110560058-110560080 GACTTTGTACAGAAGCAAATTGG + Intronic
1113814419 13:113161539-113161561 AACTGGGCACAGAAGGAAGCGGG + Intronic
1116385652 14:44326585-44326607 CCGTTTGGAAAGAAGGAAGTAGG + Intergenic
1118546147 14:66891440-66891462 CACTTGCCAAAGAATGAAGTTGG + Intronic
1119607508 14:76033387-76033409 GACCTTGGACAGGAGGAAGTAGG + Intronic
1119994084 14:79232813-79232835 AACTTTACATAGAAGAAAGTTGG - Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1120662805 14:87270716-87270738 TACTTTGCACTGAAGGAGATGGG + Intergenic
1122186222 14:99998832-99998854 CATTTTGCTCAGGAGGAAATTGG + Intronic
1122924509 14:104893400-104893422 GACCTTGCACAGACGGAAGGTGG + Intronic
1123440109 15:20284475-20284497 CCCTTTACACAGAAAGAAATTGG - Intergenic
1127211165 15:56776389-56776411 TACTTTGAACTGAAGGAAATTGG + Intronic
1128245006 15:66127109-66127131 CACTTTACAGAGGTGGAAGTAGG + Intronic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1130029868 15:80302939-80302961 CACATTGGAAAGAATGAAGTCGG - Intergenic
1130196631 15:81785446-81785468 CACTTTACAGAGAAGGAAACTGG + Intergenic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1131071575 15:89469835-89469857 CACATTGCACAGGAGGGAGTTGG + Intergenic
1132936283 16:2482951-2482973 CACTTGGCTCAGAAGGAAAACGG + Intronic
1133855325 16:9544238-9544260 CCCTTAGCACAGAGGCAAGTGGG - Intergenic
1134366699 16:13585563-13585585 CACCTTGCAGAGGAGGAAGCAGG + Intergenic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1134839265 16:17388521-17388543 CATTTTGCAGAGGAAGAAGTTGG - Intronic
1135056308 16:19234696-19234718 CACTTTACACAAAAGTAAGCTGG - Intronic
1135201797 16:20443959-20443981 CACATTGCACAATAGGAGGTTGG - Intergenic
1135217307 16:20583907-20583929 CACATTGCACAATAGGAGGTTGG + Intergenic
1136079115 16:27839994-27840016 CACTGTGCACAGCACAAAGTAGG + Intronic
1136845064 16:33569960-33569982 CCCTTTACACAGAAAGAAATTGG + Intergenic
1137008126 16:35297352-35297374 CACTTTCCACAAAAGGAATTGGG + Intergenic
1137698224 16:50477119-50477141 CACTTTGTCCAGCAAGAAGTGGG + Intergenic
1137782044 16:51105712-51105734 CACTTAGCACACAAAGAAGCTGG - Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142429258 16:90017761-90017783 CACTTTGCAGACAAGGAAACAGG + Intronic
1203106772 16_KI270728v1_random:1418613-1418635 CCCTTTACACAGAAAGAAATTGG + Intergenic
1203155232 16_KI270728v1_random:1870258-1870280 CCCTTTACACAGAAAGAAATTGG + Intergenic
1142583582 17:956787-956809 CACTTTACAGATGAGGAAGTGGG + Intronic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1146836529 17:36115179-36115201 CACTTTGCGGTTAAGGAAGTGGG + Intergenic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147323999 17:39661764-39661786 CATTCTGCAGATAAGGAAGTTGG - Intronic
1147689881 17:42308528-42308550 CACTTTGCAGAGAAGAGAGCTGG - Intronic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1149450007 17:56742621-56742643 CACTATGTAAAGATGGAAGTAGG + Intergenic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1150633597 17:66897610-66897632 CATCTTGCAGAGAAGGAAGGAGG - Intergenic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1153995990 18:10441833-10441855 CACTTTACAAAGGAGAAAGTGGG + Intergenic
1155547665 18:26931587-26931609 CTCTTTGCTCAGGAGGAAGCAGG - Intronic
1156550663 18:38012927-38012949 AACTTTGCATAAAAGGAAATAGG - Intergenic
1156838652 18:41585543-41585565 CTCTTTTCACAGAAGAAAGAGGG + Intergenic
1157020904 18:43780585-43780607 CAGGTTGCACTGGAGGAAGTAGG + Intergenic
1158282499 18:55842802-55842824 CACTAAGCAGAGAAGGAAGAAGG - Intergenic
1162847840 19:13407415-13407437 CATTTTACAGAGAAGGAAATAGG - Intronic
1163709821 19:18839968-18839990 CACTTTGCCTAGAAGGAGGGAGG + Intronic
1164461195 19:28449521-28449543 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1164965739 19:32481098-32481120 CACTTTCCTCAGAAGGGAGAAGG - Intronic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167615567 19:50531054-50531076 CACTTTTCAGAGAAAGAAGATGG + Intronic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
926765541 2:16320112-16320134 CACTTTACAAGGCAGGAAGTCGG - Intergenic
927211784 2:20643297-20643319 CCCTCTGCACAGAACCAAGTGGG + Intronic
929054145 2:37861775-37861797 CACTTGTCCCAGAAGGCAGTGGG - Intergenic
929582065 2:43087663-43087685 CATTTTCCAGATAAGGAAGTTGG + Intergenic
930217801 2:48714875-48714897 CATTTTGCAAAGAAGGAAATAGG + Intronic
930920521 2:56748001-56748023 CACTTTGGAGAGAAGAAAATGGG - Intergenic
931826850 2:66009377-66009399 CACTTTGCTCACAAGGAAACTGG + Intergenic
933587617 2:84196338-84196360 AACAATGCACAGAAGGAATTAGG - Intergenic
934989386 2:98910799-98910821 CACTTTGCAGAAAAGGAAATGGG - Intronic
935623667 2:105150502-105150524 CACTTTACAGATAAGGAAGAAGG + Intergenic
936068423 2:109349474-109349496 CACTGGGCAGAGAAGCAAGTTGG - Intronic
936341004 2:111632761-111632783 CACCTTGCACTGAATGATGTGGG + Intergenic
938318417 2:130345818-130345840 CACATTGCACAGCGTGAAGTAGG - Exonic
938942159 2:136178826-136178848 TACTTTGAACTGAAGGAAATTGG - Intergenic
939055091 2:137355787-137355809 CACTTTACAGAGAAGGAAAAAGG - Intronic
939727004 2:145733276-145733298 CTCTATGCAAAGAAGGAAGCAGG + Intergenic
940072818 2:149708656-149708678 CACATAGCAGAGAAGGAGGTGGG + Intergenic
940689211 2:156894163-156894185 CACTTAGCAGATAAGGAATTTGG + Intergenic
941359900 2:164539042-164539064 CATTTTCCACTGAAGCAAGTTGG - Intronic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
943267034 2:185745150-185745172 CACTGGGCACAGAATGAAGTGGG - Intronic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
943392414 2:187285843-187285865 CAGTTTGCAGATAAGGAAATGGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947446018 2:230163166-230163188 TACATAGCACAGGAGGAAGTTGG + Intergenic
948427116 2:237895252-237895274 CCCTTTGCACAGCAGGGGGTGGG - Intronic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169147279 20:3261015-3261037 CACCTGTCACAGAAGGAACTGGG + Intronic
1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG + Intergenic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1172320092 20:33989642-33989664 CACTTTACAGAGGAGGAAATTGG + Intergenic
1173054702 20:39599754-39599776 CAATTTCCACAGAAGGATGAAGG + Intergenic
1173423632 20:42924709-42924731 CACTTTTCAGATAAGGAAATGGG + Intronic
1173985956 20:47261688-47261710 CCCATGGCACAGAAGCAAGTAGG - Intronic
1174401571 20:50278656-50278678 TACCTTGCTCAGAAGGAAGTCGG - Intergenic
1175443978 20:59007738-59007760 CCTTTTGCAGAGAAGGAAGGAGG + Intergenic
1175678738 20:60968985-60969007 GATTCAGCACAGAAGGAAGTGGG - Intergenic
1176985858 21:15434645-15434667 CACTTTGTATTAAAGGAAGTTGG - Intergenic
1177182512 21:17758403-17758425 TACTTTGGACTGAAGGAAATTGG + Intergenic
1177533935 21:22399988-22400010 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1179446133 21:41432052-41432074 TACTTTGCAAAGAAGGAAGATGG + Exonic
1179883153 21:44301791-44301813 CACTTTGCAAACAAGGAAGCTGG - Intronic
1180137813 21:45872418-45872440 CACTTTTCACAGAAGTGGGTGGG - Intronic
1182213324 22:28694872-28694894 CCCTTTACACAGAAAGAAATTGG + Intronic
1182417566 22:30231259-30231281 CACTTTGCATACGAGGAAATGGG + Intergenic
1182780866 22:32866413-32866435 CATTTTGCAGACAAGGAAATTGG + Intronic
1183725064 22:39584032-39584054 GACTTTGGAAAGAAGGCAGTGGG + Intronic
1183843423 22:40519519-40519541 CAGTTTGGACACAAGGAGGTTGG - Intronic
1184713841 22:46269046-46269068 CACTTTGTACTGGAGGACGTGGG + Intronic
1184766643 22:46575992-46576014 CCCTTGAGACAGAAGGAAGTGGG + Intronic
1184860854 22:47172717-47172739 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1184994805 22:48197611-48197633 GAGCTTGCACAGTAGGAAGTGGG - Intergenic
1185125694 22:49009538-49009560 CAATTTCCAGAGAAGGAAGCAGG - Intergenic
950486111 3:13274823-13274845 TGCTTTGCAGAGAAGGAACTTGG + Intergenic
950728800 3:14937986-14938008 CATTTTGCACGTAAGGAAATGGG + Intergenic
952970345 3:38646832-38646854 CACTTGACAGAGAAGGAAGATGG + Intronic
953556256 3:43949046-43949068 CACTTTCCTCAGAAGAATGTGGG - Intergenic
953835143 3:46336322-46336344 AACTTTGAAAAGAAGAAAGTTGG + Intergenic
955157364 3:56429779-56429801 CCCTTTGCACATAAGAAATTTGG + Intronic
955576646 3:60372215-60372237 GACTTCTCACAGAAGGAGGTAGG - Intronic
955600156 3:60636457-60636479 CACTTTCCACAAAAGGGAGCTGG + Intronic
956992239 3:74780392-74780414 AACTTTTCACAGAAGTAAGTGGG - Intergenic
957288989 3:78252676-78252698 CACTTTGAACATAAGGACATAGG + Intergenic
958691055 3:97466782-97466804 CAATATGCACAAGAGGAAGTTGG - Intronic
959434006 3:106290705-106290727 CACTATGCACCTAAGGAAGCTGG - Intergenic
963383164 3:144557512-144557534 CACTGTGAATAGAAGAAAGTGGG - Intergenic
964182808 3:153908247-153908269 GACCTTGATCAGAAGGAAGTGGG + Intergenic
964394278 3:156229018-156229040 CCCTTTACACACAAGGAAGAGGG - Intronic
965377680 3:167946203-167946225 CACTTGCCAAAGAATGAAGTTGG + Intergenic
966440570 3:179940182-179940204 GACTTTGCAGACAGGGAAGTGGG + Intronic
967107101 3:186262810-186262832 TAGTCTGCAAAGAAGGAAGTGGG - Intronic
967119076 3:186366558-186366580 CACTTTGCAGAAGAGGAAATTGG - Intergenic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967941887 3:194772552-194772574 CACTTAGAACACAAGGAAGTTGG + Intergenic
967979402 3:195056610-195056632 CCATTTGCACAGCAGGAAGCAGG + Intergenic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
968814438 4:2814723-2814745 CACTTTACACTGGAGGAGGTGGG + Intronic
969175437 4:5395357-5395379 CATTTTGCAGATGAGGAAGTAGG - Intronic
969479211 4:7438398-7438420 AACTTTACAGAGAAGGAAGCTGG - Intronic
970114656 4:12681155-12681177 GACTTTATTCAGAAGGAAGTAGG - Intergenic
971028124 4:22608307-22608329 CTCTTTGCTCAGGAGGAAGCAGG - Intergenic
971101917 4:23476272-23476294 CAATTTGTACAAAAGCAAGTTGG - Intergenic
971739719 4:30503870-30503892 CACTTTGGACACAAGGCAGAAGG + Intergenic
972287007 4:37658850-37658872 CAATTAGCACAGCAAGAAGTAGG + Intronic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
975028306 4:69579786-69579808 CACTATGCACAGAAGCATTTAGG - Intergenic
975698143 4:77034807-77034829 CGCTTTGGACAGAGGAAAGTGGG + Exonic
975732650 4:77352971-77352993 CACTTAGTACAAAAGGAAGAGGG - Intronic
976366237 4:84235472-84235494 TACTTTGCACAATAGGATGTAGG - Intergenic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976914566 4:90355248-90355270 TACATTTCCCAGAAGGAAGTGGG + Intronic
978305684 4:107325862-107325884 TACTTTGGACAGAGGGAAGAGGG + Intergenic
978540861 4:109815350-109815372 CACCTTGCAAGGAATGAAGTTGG - Intergenic
979621738 4:122805668-122805690 CAATTTGCACAGAAGCTATTTGG + Intergenic
980015618 4:127646702-127646724 CAGTTTTCACAAAAGCAAGTTGG + Intronic
981833719 4:149030609-149030631 CACTTTGGATAGATGGAAGGAGG + Intergenic
982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG + Intergenic
982696336 4:158605975-158605997 AACATTTCACTGAAGGAAGTGGG - Intronic
982805531 4:159758201-159758223 AGCATGGCACAGAAGGAAGTGGG + Intergenic
983625655 4:169799250-169799272 AACTTTGCAGACAAGGAAGGAGG - Intergenic
985342392 4:188968882-188968904 CACTTGTCAAAGAAGGAGGTTGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
987681703 5:21144383-21144405 AACTTTGCACAGATGTGAGTGGG - Intergenic
989351247 5:40489185-40489207 CTCTTTGCAAAGAAGCAACTAGG - Intergenic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
990285362 5:54296384-54296406 CACTTTGCATACAAGGAAACAGG + Intronic
992009450 5:72512203-72512225 CACTGTGCAAAGAATGAAGGAGG + Intergenic
996462072 5:123756949-123756971 CACTTTACACAGAAGTTAGGAGG + Intergenic
997750760 5:136343315-136343337 CACTTTGAACTGAAGGAGATTGG + Intronic
997888111 5:137649691-137649713 CATTTTGCAGATGAGGAAGTTGG - Intronic
999088879 5:148917585-148917607 AACTTTGGACAGAAGCAAGAAGG + Intergenic
1002960180 6:1906884-1906906 CACTTTACATAGCAGGAAATGGG + Intronic
1004451711 6:15753827-15753849 CACCTGGCACTGAAGGAAGATGG - Intergenic
1004813367 6:19285302-19285324 CACATTCCAAAGAATGAAGTTGG + Intergenic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1006963668 6:37960431-37960453 TACTTTGGACAGAAGGCAATGGG + Intronic
1007158837 6:39772359-39772381 CACTATTCAGAGAAGGAAGGTGG + Intergenic
1008612467 6:53197081-53197103 CACTTTAAACAGAAGGAAAATGG - Intergenic
1011489307 6:87874310-87874332 TACTTTGAACTGAAGGAGGTGGG - Intergenic
1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG + Intergenic
1014121336 6:117728648-117728670 CATTTTGCAGATAAGGAAATGGG + Intergenic
1014265252 6:119269561-119269583 CACTTTCCACAGAAACAGGTTGG - Intronic
1015131681 6:129818188-129818210 CACTTGGCACACAAGGATGGAGG + Intergenic
1015478719 6:133682838-133682860 CTCTTTGCACACAGGGATGTTGG - Intergenic
1016240849 6:141928514-141928536 TAAATTGCACAGAAGAAAGTTGG - Intergenic
1016376855 6:143430181-143430203 CACTTAACACAGCAGGAAGCAGG - Intronic
1017137515 6:151161374-151161396 CACTTTGGAGAGAAGGAACAGGG - Intergenic
1017652745 6:156598243-156598265 CACTTTTCACATTAGGAAGGGGG - Intergenic
1018543462 6:164909868-164909890 CACTTTCCACAAATGGATGTTGG - Intergenic
1019290782 7:249023-249045 CTCTGTGCACAGAAGGACATTGG - Intronic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1020429723 7:8106620-8106642 GACTTTACACAGAAGGATGCTGG + Intergenic
1020799780 7:12719279-12719301 CAATTTTCAGAGAAGGCAGTTGG + Intergenic
1020893739 7:13913439-13913461 CACTTTACAGATGAGGAAGTTGG - Intronic
1022509806 7:30927844-30927866 CACCTGGCCCAGAAGGAAGCAGG + Intergenic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1024517786 7:50274517-50274539 CAGCTTGCTCAGGAGGAAGTGGG + Intergenic
1027707490 7:81552538-81552560 CAGTTTGCACAGAAAGAAAGAGG - Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1029284482 7:99456411-99456433 CACTGGGAACAGCAGGAAGTGGG - Exonic
1031014716 7:116560532-116560554 CCCTTTGCCCAGAAAGAAGATGG + Exonic
1032403473 7:131639533-131639555 CCCTTTGAACTGAAGGAACTAGG - Intergenic
1032716405 7:134512641-134512663 CACTTTGAAAAAAAGGAAATTGG - Intergenic
1034551023 7:151820758-151820780 CACCTTCAACAGAAGGAACTTGG + Intronic
1034831907 7:154315977-154315999 CATTTAGCACACAAGCAAGTGGG - Intronic
1037882539 8:22579990-22580012 CACTTTGCCAAGAACGAGGTGGG + Intronic
1037931348 8:22882187-22882209 CACTTTTCAGGGAAGGAAATGGG + Intronic
1038575995 8:28703401-28703423 CAGTTTGGAGAGAAGTAAGTCGG + Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1040391261 8:46952758-46952780 CACTGGGCACAGAAGGGAGGTGG - Intergenic
1041147682 8:54895156-54895178 GACTTTGAACTGAAGGACGTTGG + Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1041820252 8:62023694-62023716 CACATTGCCAAGAATGAAGTGGG + Intergenic
1044294340 8:90510309-90510331 AATTTTACACAGAAGGCAGTCGG - Intergenic
1044920634 8:97166100-97166122 TACTTTGCAGGCAAGGAAGTGGG - Intergenic
1044996759 8:97844692-97844714 GACTTTCAACACAAGGAAGTAGG - Intronic
1045685129 8:104703699-104703721 CACTTTGGAGAGAAAGATGTGGG - Intronic
1045849797 8:106681324-106681346 AAGTTTGCATAGAAGGATGTAGG + Intronic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1048305715 8:133283173-133283195 CATTTTGTAGAGGAGGAAGTTGG - Intronic
1048883404 8:138888539-138888561 CACTTTGCCCTGAAGGTGGTAGG - Intronic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050732883 9:8729356-8729378 GACTTTGCAGAGAAGCAAGCTGG + Intronic
1050767315 9:9150971-9150993 CACTTTGCACACAAGATCGTGGG + Intronic
1050998930 9:12256490-12256512 CACTTTCCCCAGGAGGTAGTGGG + Intergenic
1052102025 9:24459991-24460013 CTCTTTGCACATGAAGAAGTCGG - Intergenic
1055752865 9:79526844-79526866 CATGTGGGACAGAAGGAAGTGGG - Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1057867043 9:98689927-98689949 CACTTTGCAGGGAAGAAATTGGG - Intronic
1058582151 9:106470189-106470211 TACTTTGCAGATAAGGAAATTGG + Intergenic
1058669356 9:107347591-107347613 CATCTTCTACAGAAGGAAGTGGG - Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059676728 9:116547575-116547597 CACTTCACAGATAAGGAAGTAGG - Intronic
1060118599 9:120966768-120966790 GACTGGCCACAGAAGGAAGTAGG + Intronic
1060262934 9:122092159-122092181 CACTTTACAGAGAAGGTAATAGG + Intronic
1060689016 9:125639576-125639598 CACTATGTACACAGGGAAGTGGG + Intronic
1061241658 9:129378018-129378040 GTCTTTACACAGAAGGATGTCGG + Intergenic
1061752048 9:132785718-132785740 CACTGTGGACAGAATGAAATTGG - Intronic
1185840313 X:3383445-3383467 CTATTTGCAGAGAAGGAAGGTGG - Intergenic
1186215062 X:7290775-7290797 CATTTTACAGAGAAAGAAGTGGG - Intronic
1186284704 X:8031106-8031128 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186284707 X:8031140-8031162 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186721893 X:12313382-12313404 CACTTTGCAAAACAGGTAGTGGG - Intronic
1187300418 X:18043796-18043818 CACTGTGGAAAGAAGGGAGTAGG + Intergenic
1189206030 X:39239591-39239613 CACTTTCCACATAAGGAAATTGG + Intergenic
1190067218 X:47249610-47249632 CATTTTGCAGATAAGGAAGCAGG + Intergenic
1190803975 X:53817744-53817766 CAGTTTCCATAGTAGGAAGTGGG + Intergenic
1190927210 X:54921035-54921057 CAGTTCGCACGGGAGGAAGTAGG + Intronic
1193476081 X:81967724-81967746 CACTTTACAGTGAAGGTAGTAGG + Intergenic
1193492258 X:82164432-82164454 CCCTTTGCACAGAAAGACATGGG + Intergenic
1195802328 X:108726836-108726858 CACTTGGCACAGAAGCAGCTGGG - Intronic
1198685993 X:139228691-139228713 CACTTTGTTCTGAAGGCAGTGGG + Intergenic
1199151124 X:144488293-144488315 TACTTTGCACATTAGGAAGCGGG + Intergenic