ID: 1038584554

View in Genome Browser
Species Human (GRCh38)
Location 8:28777298-28777320
Sequence GGGCCACGGAACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038584554_1038584559 4 Left 1038584554 8:28777298-28777320 CCAGCACAGTGGTTCCGTGGCCC 0: 1
1: 0
2: 1
3: 7
4: 100
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038584554 Original CRISPR GGGCCACGGAACCACTGTGC TGG (reversed) Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
906113745 1:43341657-43341679 GGACCACAGAAGCCCTGTGCTGG - Intronic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG + Intergenic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1067031520 10:42880941-42880963 GGGGCACGCAACCTCTGAGCTGG + Intergenic
1067226477 10:44379520-44379542 GTGCCCCTGAACCACTGTTCTGG - Intronic
1067700020 10:48564679-48564701 GGGCTGCAGAAACACTGTGCAGG - Intronic
1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG + Intergenic
1070946292 10:80394718-80394740 GGCCCACTGAGTCACTGTGCTGG - Intergenic
1077442745 11:2576259-2576281 GGGACACTCAACCACTGAGCCGG - Intronic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1085043403 11:73340040-73340062 GGGCCACGGTACCCCTATGCAGG - Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089201225 11:116725796-116725818 GGGCGATGGAGCCACTCTGCAGG - Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1102585592 12:113920565-113920587 GGGCCACGGAGGCACTTGGCAGG - Intronic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1112665858 13:101572411-101572433 AGGCCCCGGCACCACTGTACAGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119372751 14:74161679-74161701 TGGCCACGGGAACACTCTGCCGG + Intronic
1121837071 14:97101805-97101827 AGGTCACGGAACTACTGGGCGGG - Intergenic
1122297211 14:100712303-100712325 GGGCCACAGAGGCAATGTGCCGG + Intergenic
1122308292 14:100779199-100779221 GAGCAGCGGAGCCACTGTGCTGG - Intergenic
1122479737 14:102039288-102039310 CGGCCAAGGAGCTACTGTGCGGG - Intronic
1122479747 14:102039328-102039350 TGGCCAAGGAGCTACTGTGCAGG - Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1126349443 15:47729432-47729454 GGGCCAAGGGACCACTTTGGAGG + Intronic
1127625954 15:60780346-60780368 AGGCCTGGGAACCACTGGGCTGG + Intronic
1130126131 15:81095579-81095601 GGGCACCAGAACCACTGTGCAGG - Intronic
1134093852 16:11405921-11405943 TGGCCAAGGAGCCACTGGGCTGG - Intronic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1147552332 17:41452492-41452514 GGTCCACTTAACCACTGTGTTGG - Intergenic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1155080040 18:22400170-22400192 GGGTCACAGAACCAGTGAGCTGG + Intergenic
1157499019 18:48177210-48177232 GGGCGAGGGGACCACTTTGCTGG - Intronic
1161668613 19:5591697-5591719 GGGCCACTGTACTGCTGTGCAGG - Intronic
1162420992 19:10565993-10566015 GGGCCACAGAACCGCCATGCCGG - Exonic
1165937022 19:39395557-39395579 GGGCCACAGGACCGGTGTGCTGG + Intronic
1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG + Intronic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167439539 19:49500381-49500403 GGGCCCCGGTACCACTGAACAGG - Intergenic
925616805 2:5751543-5751565 GGGCCATGAAACCTTTGTGCTGG + Intergenic
927971341 2:27307747-27307769 GGGGCACGGAACCAGGGTGGCGG - Exonic
929417343 2:41756904-41756926 GGGACACTGAACTACAGTGCAGG - Intergenic
934527004 2:95058262-95058284 GGGCCCGGGAGCCACTCTGCTGG - Intergenic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
937327556 2:121000464-121000486 GGGACACAGGACCACTGTGATGG - Intergenic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
944372161 2:198997305-198997327 GGGTCACGAATCCACTGTGGGGG - Intergenic
946569600 2:221008837-221008859 GGGTCAAGGAACCACTATACAGG + Intergenic
948048969 2:234964989-234965011 GGGTCACGGGAGCACTGGGCTGG - Intronic
948387629 2:237591463-237591485 GGGCGGAGGAACCACTGTGGTGG - Intronic
948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG + Intronic
1169483497 20:6006436-6006458 GGCCAGCGGAACCACTGTTCGGG + Exonic
1171978012 20:31607585-31607607 GGGCCACAGAACCACACTGTGGG + Intergenic
1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG + Intronic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1181575586 22:23792434-23792456 GGGTCACGGCAGCTCTGTGCAGG + Intronic
1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG + Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
959117284 3:102193298-102193320 GGGCCACAGAACCACTAGACAGG + Intronic
959567230 3:107844873-107844895 AGGCCACAGAAACACTGAGCAGG + Intergenic
959638700 3:108606210-108606232 GGCCCACTGAACCACTCAGCAGG - Intronic
962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG + Exonic
967971830 3:195004992-195005014 GGGCCACCCACCCACAGTGCAGG + Intergenic
968429356 4:546276-546298 GGGCACCACAACCACTGTGCTGG - Intergenic
968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG + Intronic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG + Intronic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
995204943 5:109469044-109469066 GGGCCATGGAACCAATGTAGTGG + Intergenic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1002782933 6:380675-380697 AGGACACGGAGCCACTGTGAGGG - Intergenic
1008865482 6:56204646-56204668 GGGTCAGGGACCCACTGTGGAGG - Intronic
1018067145 6:160132119-160132141 AGGCCACCGCACCACTGTCCTGG - Intronic
1018685084 6:166298050-166298072 GGGCCATGGGTCCCCTGTGCTGG - Intergenic
1019572734 7:1720482-1720504 GAGCCAGGGAACCAGCGTGCAGG + Intronic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1020210850 7:6157215-6157237 GTGCAACGGAACCACACTGCAGG - Intronic
1025990504 7:66493411-66493433 GACCCACAGAAACACTGTGCTGG + Intergenic
1026329105 7:69336690-69336712 GAGCCACTGAGCCACTGTGCAGG + Intergenic
1027213166 7:76166424-76166446 GACCCACAGAAACACTGTGCTGG + Intergenic
1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG + Intronic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1038224804 8:25645829-25645851 TGGCCACAGAGCCACTGTCCCGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1049463832 8:142742126-142742148 GGGTCACGGCTCCACTCTGCAGG - Intronic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1057817764 9:98308209-98308231 GGGCCACCAAGCCACTGTGAAGG + Intronic
1061544859 9:131298768-131298790 TGGCCAGGGAACCAGAGTGCTGG - Intronic
1061766787 9:132886554-132886576 AGGGCACGGAGCCACTGAGCTGG + Intronic
1187203478 X:17158751-17158773 GGGGAAAGAAACCACTGTGCAGG + Intergenic
1199671078 X:150148822-150148844 GGGCCACAGCACCACAGTGGTGG - Intergenic
1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG + Intergenic