ID: 1038584554

View in Genome Browser
Species Human (GRCh38)
Location 8:28777298-28777320
Sequence GGGCCACGGAACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038584554_1038584559 4 Left 1038584554 8:28777298-28777320 CCAGCACAGTGGTTCCGTGGCCC No data
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038584554 Original CRISPR GGGCCACGGAACCACTGTGC TGG (reversed) Intronic