ID: 1038584559

View in Genome Browser
Species Human (GRCh38)
Location 8:28777325-28777347
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038584555_1038584559 -10 Left 1038584555 8:28777312-28777334 CCGTGGCCCTGCCTTCCTGCTAC No data
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data
1038584554_1038584559 4 Left 1038584554 8:28777298-28777320 CCAGCACAGTGGTTCCGTGGCCC No data
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data
1038584551_1038584559 23 Left 1038584551 8:28777279-28777301 CCAGCGAGCAGTGGCTGAGCCAG No data
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data
1038584550_1038584559 24 Left 1038584550 8:28777278-28777300 CCCAGCGAGCAGTGGCTGAGCCA No data
Right 1038584559 8:28777325-28777347 TTCCTGCTACGCGCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type