ID: 1038586383

View in Genome Browser
Species Human (GRCh38)
Location 8:28792988-28793010
Sequence GGGAAAAAAACGACCACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038586379_1038586383 0 Left 1038586379 8:28792965-28792987 CCTGTATGAGTCTAAACACAGCG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1038586383 8:28792988-28793010 GGGAAAAAAACGACCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038586383 Original CRISPR GGGAAAAAAACGACCACAGA AGG Intronic
No off target data available for this crispr