ID: 1038587729

View in Genome Browser
Species Human (GRCh38)
Location 8:28805401-28805423
Sequence GAATCTAGAGGGTCTTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038587729_1038587732 -2 Left 1038587729 8:28805401-28805423 CCACTTCAAGACCCTCTAGATTC 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1038587732 8:28805422-28805444 TCCCATTCCTCAAGCATTCCTGG No data
1038587729_1038587737 22 Left 1038587729 8:28805401-28805423 CCACTTCAAGACCCTCTAGATTC 0: 1
1: 0
2: 0
3: 15
4: 108
Right 1038587737 8:28805446-28805468 AGAAGAAAAGTCAATCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038587729 Original CRISPR GAATCTAGAGGGTCTTGAAG TGG (reversed) Intronic
903737638 1:25540474-25540496 GATTCAAGAGGGGCTTGAAAGGG - Intergenic
905297404 1:36962924-36962946 AAATCTAGAGGGACATGATGAGG + Intronic
907621768 1:55988529-55988551 GAAACTAGGTGGTCTGGAAGAGG + Intergenic
911696677 1:100896479-100896501 GAACTGGGAGGGTCTTGAAGAGG + Intronic
912716397 1:111987017-111987039 GAATCTTGAGGGGGTTCAAGAGG + Intronic
916183894 1:162112443-162112465 GAACCCAGAGGGGTTTGAAGAGG - Intronic
916746135 1:167686300-167686322 GAATAAAGAGGTTGTTGAAGTGG - Intronic
917404258 1:174686455-174686477 GATTCTAGTGGGTTTAGAAGGGG - Intronic
920813243 1:209306711-209306733 GGATCTTGAGGATCTTGAAGGGG - Intergenic
921712189 1:218384092-218384114 GAATCAAGATGTTCTAGAAGAGG - Intronic
921744278 1:218720566-218720588 GCATCTAGAGGTGCATGAAGTGG + Intergenic
1064033758 10:11899521-11899543 GGATCTAGATGGTCTAGATGGGG - Intergenic
1064048478 10:12040615-12040637 AAATCTAGAAGTTCATGAAGAGG + Intronic
1078095005 11:8291482-8291504 GAATTTAGAGGGTCCAGAGGAGG - Intergenic
1079510884 11:21208801-21208823 GAATCTATAAGCTCTTAAAGTGG + Intronic
1081078940 11:38714653-38714675 AAATCTAGAGGTTCTAAAAGGGG - Intergenic
1081419801 11:42862458-42862480 GAGTCTAGAGGGTCTAGAAATGG - Intergenic
1081720419 11:45285054-45285076 GGATCTAGAGGGCCTTTAGGAGG + Intronic
1086140944 11:83499594-83499616 GAGTGTAGAGGGTGTTGAAAGGG - Intronic
1086204996 11:84247448-84247470 GAAACTAGAGAGTATTGAAGTGG + Intronic
1086975233 11:93124438-93124460 GATTCTTGAGGCTCTTGAAATGG + Intergenic
1087136885 11:94730204-94730226 GAATCTAGAGGGGCAGGCAGAGG - Intronic
1088133124 11:106520009-106520031 GAATCTAGAGGGGCATGTGGAGG + Intergenic
1094329939 12:29280291-29280313 CAATCTAGAGGGTCTTGCCTAGG - Intronic
1095495045 12:42775456-42775478 GAATGTAGAGGCTCTGGAACAGG - Intergenic
1095975571 12:47938858-47938880 GAATCTAGTGGGGCTGGAGGAGG - Intronic
1105584733 13:21733464-21733486 GAATCTAGAGGGAGAAGAAGAGG + Intergenic
1106797052 13:33217388-33217410 GGATGGAGAGGGTTTTGAAGAGG - Intronic
1106885442 13:34179673-34179695 GAATCAAGAGTGTTTTGGAGTGG + Intergenic
1109555222 13:63965433-63965455 GAATTTTGAGGGTTTTTAAGAGG + Intergenic
1113300738 13:109016629-109016651 GAATCTAGGTGCTCTTGTAGTGG + Intronic
1119438315 14:74612057-74612079 GAGTCTAGGGGGCCCTGAAGCGG + Exonic
1119694886 14:76705337-76705359 GAAGCTGGAGGGTCAGGAAGGGG - Intergenic
1120488901 14:85151789-85151811 GAAGATAGAGGTTCTTGCAGGGG - Intergenic
1124072841 15:26411818-26411840 GAATCTTGAGGGACTGGTAGTGG + Intergenic
1125312790 15:38398745-38398767 GGATCTAGAGACTATTGAAGAGG - Intergenic
1128977564 15:72164722-72164744 GAGTCAAGAGGGCCTTCAAGGGG - Intronic
1129222420 15:74139035-74139057 GATCCTAGAGGGTCTCGAGGAGG - Intergenic
1131050328 15:89343416-89343438 GAGGCTAGACAGTCTTGAAGGGG - Intergenic
1131704705 15:94980694-94980716 AAATCTAGTGGGTCTAAAAGAGG - Intergenic
1135222742 16:20626971-20626993 AATTCAAGAGGGTCTGGAAGAGG - Intronic
1135532212 16:23264452-23264474 GGGTTGAGAGGGTCTTGAAGGGG + Intergenic
1136284937 16:29235131-29235153 GAATCTAAAGGGTCCTGGAGTGG + Intergenic
1142089999 16:88204755-88204777 GAATCTAAAGGGTCCTGGAGTGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1147688034 17:42299035-42299057 GATTCTTGAGGGGCTGGAAGGGG - Intronic
1148522467 17:48292874-48292896 AAATCTAAAGGATTTTGAAGAGG + Intronic
1149272614 17:54997059-54997081 GAATCTAGACTGTGTGGAAGAGG + Intronic
1151286366 17:73114439-73114461 GACTCTGCAGAGTCTTGAAGTGG - Intergenic
1153750758 18:8227930-8227952 GAATCCAGAGGGGCTGGAACCGG - Intronic
1160686592 19:439542-439564 AAGTCTACAGGGTCCTGAAGGGG + Intronic
925276599 2:2653505-2653527 GACTCCAGAGGGTGTTGAATAGG - Intergenic
925442264 2:3899010-3899032 GAATACAGATGGTCTGGAAGAGG - Intergenic
926687070 2:15706213-15706235 GGACCTAGAGGGACTTGAAGTGG - Intronic
926847501 2:17158520-17158542 GAATCTGGAGAGTGTTGAAATGG + Intergenic
928224184 2:29433377-29433399 GTTTCTAGAGGGTTTTGAGGAGG + Intronic
929054012 2:37860546-37860568 GAATTAAGAGGGTCTTCCAGGGG + Intergenic
932467812 2:71934808-71934830 CAATCTAGAGGGTTCAGAAGGGG + Intergenic
932894023 2:75621537-75621559 GAATCTTGGGAGTCTTGGAGGGG - Intergenic
933414219 2:81965299-81965321 GAAAATAGAGGGACCTGAAGAGG - Intergenic
933423722 2:82084528-82084550 AAATCTGGAGGGACTTAAAGAGG - Intergenic
943008265 2:182413376-182413398 GAGGCTAGAGGGCTTTGAAGTGG + Intronic
946451125 2:219780335-219780357 GAATCTAGAGGGATTTCTAGAGG + Intergenic
1168737775 20:158233-158255 GAATGTAGAGGGTCAGGAATAGG - Intronic
1169039330 20:2480136-2480158 TAATCTCTAGGGTTTTGAAGAGG - Intronic
1171228361 20:23460288-23460310 GAATCCAGAGGGTCATGGGGTGG + Intergenic
1172568065 20:35946562-35946584 AAATCTATAGGGTCTTGAAAAGG - Intronic
1172790714 20:37503523-37503545 GAATGAAGAGGGGCTGGAAGAGG - Intronic
1177242593 21:18478898-18478920 GAGTCTGGAGGGTGTTGAAAGGG - Intronic
1181088454 22:20456136-20456158 GAATCTAGAGGGACTTTTTGGGG - Intronic
1181672679 22:24433024-24433046 GAAACTATAGGGTCTTCAGGGGG + Intronic
1185274409 22:49944163-49944185 GATTCTGGCGGGTCTTGAAGTGG - Intergenic
950291508 3:11788264-11788286 GATTATAGTGGGTCTTGAATAGG + Intergenic
952986814 3:38793188-38793210 GAATATAGAGGCTATTGATGGGG - Intronic
953022163 3:39121539-39121561 GAATCTAGAGGCTCTGCATGTGG - Intronic
959021377 3:101191078-101191100 GTAGCTAGAGGGACTTGATGTGG - Intergenic
959443054 3:106403626-106403648 GAAGCTGGAGGCTCTTGAATAGG + Intergenic
960327863 3:116318959-116318981 AAATGTTGAGGCTCTTGAAGTGG - Intronic
961138799 3:124537938-124537960 GAATGTAAAGGGTTTAGAAGAGG + Intronic
963860688 3:150307379-150307401 ACTTCTAGAGGCTCTTGAAGAGG + Intergenic
965468109 3:169057772-169057794 GAAGATAGAGGGTCTAGAGGTGG + Intergenic
967984474 3:195084982-195085004 GCATTTCGAGGGTCTGGAAGTGG - Intronic
972223286 4:36981220-36981242 TAATCTAGAGGCTGTTGAAGAGG - Intergenic
974175201 4:58313743-58313765 AAATCTAGAGGCTTTTGCAGTGG + Intergenic
975559077 4:75692815-75692837 CAACATGGAGGGTCTTGAAGGGG + Intronic
976623529 4:87153410-87153432 GAATCCAGAGGTTCTTTAATTGG - Intergenic
977314129 4:95423959-95423981 CAATCTAGATGGTCTTAAGGTGG + Intronic
979835997 4:125368129-125368151 GAATATAGAGGTTCTTGAAATGG + Intronic
989733675 5:44677311-44677333 TCATCTAGAGGGTATTCAAGGGG + Intergenic
992320840 5:75611775-75611797 GAAGCGGGAGGGTCTTGGAGAGG + Exonic
992941859 5:81770471-81770493 GAACCTAGAAGGTCGTGAAGGGG - Intergenic
995106042 5:108380056-108380078 CAGTCTAGTGGGGCTTGAAGTGG - Intronic
996105120 5:119492312-119492334 GAATAGATAGGGTCTTGAAAGGG - Intronic
996495398 5:124149224-124149246 GAACCTATAGGTTCTTGAACGGG + Intergenic
1001976271 5:176002240-176002262 CAATCTAGAGCTCCTTGAAGTGG - Intronic
1006595109 6:35187185-35187207 GAATCTAGAGGGTCTCAAAAAGG + Intergenic
1008128622 6:47695670-47695692 GTGTCTATATGGTCTTGAAGAGG - Intronic
1010183185 6:73112233-73112255 TAAACTGGAGGGTCTTGAAGTGG + Intronic
1012305254 6:97648035-97648057 TCATCTAGAAGGTCTTGAACTGG + Intergenic
1015594987 6:134858121-134858143 GATTCTAAGGGGTCTTAAAGCGG - Intergenic
1015827222 6:137327207-137327229 GAATCTGGATGGATTTGAAGTGG - Intergenic
1015862583 6:137696335-137696357 GAATCCAGAGGGTCTCCCAGTGG - Intergenic
1016019390 6:139219785-139219807 AAATCTAGAGTATCTTGAACTGG + Intergenic
1017231008 6:152073804-152073826 GCATCTGGAGGGGCTTGAGGCGG - Intronic
1021713636 7:23441095-23441117 GAATATATAGGCTCTTGAAATGG - Intronic
1028150744 7:87368412-87368434 GGATCTGGAGGTTTTTGAAGGGG + Intronic
1034727793 7:153355858-153355880 GAAACTAGAGGGTGTTGGAGTGG + Intergenic
1035492341 7:159291382-159291404 GAATCTAGAGCATCCTCAAGGGG - Intergenic
1037452899 8:19034830-19034852 GTATCTGGAGGGCTTTGAAGTGG - Intronic
1037907747 8:22725409-22725431 GCGTCTGGAGGGTCTGGAAGTGG + Intronic
1038587729 8:28805401-28805423 GAATCTAGAGGGTCTTGAAGTGG - Intronic
1039273154 8:35905352-35905374 GAATATAGAAGGCCTTAAAGGGG + Intergenic
1042258840 8:66835231-66835253 AAATCTAGAGTATCTTGCAGTGG - Intronic
1046563970 8:115874721-115874743 GAATCCAGTGAGGCTTGAAGAGG - Intergenic
1048508195 8:135039721-135039743 CAATCAAGAGGGACTTTAAGGGG - Intergenic
1049239096 8:141527892-141527914 GGAGCCAGAGGCTCTTGAAGGGG - Intergenic
1050609596 9:7337651-7337673 GAAGGTAGATGGTCTTGGAGAGG + Intergenic
1057305221 9:93908413-93908435 GAATCCAGAGGGCCCTGAAGTGG + Intergenic
1057826938 9:98378626-98378648 GAATGCAGCGGGTCTAGAAGGGG - Intronic
1059520301 9:114934473-114934495 AGGTCTAGAGGGTCTTAAAGTGG - Intergenic
1060467844 9:123923368-123923390 GAATGTAGAGAGACTTGGAGTGG - Intronic
1189292814 X:39897803-39897825 TAATATTAAGGGTCTTGAAGAGG + Intergenic
1199268047 X:145850137-145850159 GAATCTAGAGCGTCTTCACCAGG - Intergenic
1199976187 X:152896180-152896202 CAAACTAGGGGCTCTTGAAGAGG + Intergenic