ID: 1038592310

View in Genome Browser
Species Human (GRCh38)
Location 8:28851060-28851082
Sequence AAGTAAAAGCTTAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038592308_1038592310 12 Left 1038592308 8:28851025-28851047 CCAATAACTCAGGAGGGAAAACA 0: 1
1: 0
2: 1
3: 26
4: 278
Right 1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038592310 Original CRISPR AAGTAAAAGCTTAATGAAGA AGG Intronic
No off target data available for this crispr