ID: 1038596455

View in Genome Browser
Species Human (GRCh38)
Location 8:28890550-28890572
Sequence CTTCCGCGTGGGGCGCCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038596455_1038596474 30 Left 1038596455 8:28890550-28890572 CCGACGGGCGCCCCACGCGGAAG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1038596474 8:28890603-28890625 CCTATCTCAGCCCTTCGTACTGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038596455 Original CRISPR CTTCCGCGTGGGGCGCCCGT CGG (reversed) Exonic
901602147 1:10430671-10430693 CAGCCGCGGGGGGCGCCCGGGGG - Intronic
904769076 1:32870940-32870962 CGTCCACGTCGGGCGCCCGGGGG + Intronic
904830217 1:33301500-33301522 CTTCAGCCTGAGGCGCCTGTGGG + Intergenic
922725385 1:227920658-227920680 CCTCCGTGTGGGCCACCCGTTGG - Exonic
1075705429 10:124497508-124497530 CCTCCGGGTGGGGCTCCCCTGGG + Intronic
1083845934 11:65333679-65333701 CCTGCGCGTCGGGCTCCCGTGGG + Intergenic
1089570202 11:119402705-119402727 CTCCTGCCTGGGGCTCCCGTGGG - Intergenic
1096241392 12:49961967-49961989 CCGCGGCGGGGGGCGCCCGTTGG - Exonic
1105767798 13:23578880-23578902 CTTCCCCGGGAGGCGTCCGTGGG + Intronic
1108618629 13:52159591-52159613 CTTCCGCGGGGCGGGCCCGGCGG + Exonic
1122993359 14:105249199-105249221 CTTCGTCGTGGGGCCCCCGGGGG + Exonic
1130301146 15:82680518-82680540 CTTCCGCCTTGGGCGCCAGGTGG + Exonic
1139491120 16:67286551-67286573 CTCCTGCGTGGGGCCCCCGCAGG - Exonic
1143425433 17:6832214-6832236 TTTCTGCGTGGGGCGCCCGATGG + Intergenic
1149772396 17:59331963-59331985 GTTCCGCGTGGGGTCCCCGTGGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1166367424 19:42284537-42284559 CCCCCGCGTGGGGCGGCCGGAGG + Intronic
932812281 2:74835058-74835080 CTGCCGCGTGGGGCCGCCGGGGG + Intronic
942189708 2:173457600-173457622 CTTCCCCGTGGGACTCCTGTGGG + Intergenic
947506790 2:230713449-230713471 CGCCGGCGTGGGGCGCCCGGGGG + Intronic
1171346640 20:24470352-24470374 CTTCCGCCACGGTCGCCCGTCGG - Intronic
1179825084 21:43959883-43959905 CTGCCGCCTGGGGCTCCCGTGGG + Intronic
1183586482 22:38755832-38755854 TTTCCGCGTGGGGATCCCGCGGG + Exonic
967838336 3:193982868-193982890 CTTGCCCGTGGTGAGCCCGTCGG - Intergenic
967867957 3:194205721-194205743 CTGCCTCGTGGGGAGCCGGTGGG + Intergenic
1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG + Exonic
1023254987 7:38304486-38304508 CTTGGGTGAGGGGCGCCCGTGGG - Intergenic
1023831297 7:44040267-44040289 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1029741627 7:102494573-102494595 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029759618 7:102593742-102593764 CGTCCGCGTGGCGCTCCCGCAGG + Exonic
1029776984 7:102689652-102689674 CGTCCGCGTGGCGCTCCCGCAGG + Intergenic
1038596455 8:28890550-28890572 CTTCCGCGTGGGGCGCCCGTCGG - Exonic
1048345321 8:133571263-133571285 CCTCCGCTGGGGCCGCCCGTGGG - Intronic
1062120358 9:134830853-134830875 CTGCCGCGTGGAGTGCCCCTAGG + Intronic