ID: 1038602910

View in Genome Browser
Species Human (GRCh38)
Location 8:28965668-28965690
Sequence TGCAAGGTATAAAAGCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038602903_1038602910 15 Left 1038602903 8:28965630-28965652 CCACAAGGAAGGCCCCTCAGTGC 0: 1
1: 0
2: 3
3: 16
4: 167
Right 1038602910 8:28965668-28965690 TGCAAGGTATAAAAGCTTTGAGG No data
1038602907_1038602910 1 Left 1038602907 8:28965644-28965666 CCTCAGTGCTAGAAAATGCTGGC 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1038602910 8:28965668-28965690 TGCAAGGTATAAAAGCTTTGAGG No data
1038602904_1038602910 3 Left 1038602904 8:28965642-28965664 CCCCTCAGTGCTAGAAAATGCTG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1038602910 8:28965668-28965690 TGCAAGGTATAAAAGCTTTGAGG No data
1038602905_1038602910 2 Left 1038602905 8:28965643-28965665 CCCTCAGTGCTAGAAAATGCTGG 0: 1
1: 0
2: 3
3: 18
4: 141
Right 1038602910 8:28965668-28965690 TGCAAGGTATAAAAGCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038602910 Original CRISPR TGCAAGGTATAAAAGCTTTG AGG Intronic
No off target data available for this crispr