ID: 1038604498

View in Genome Browser
Species Human (GRCh38)
Location 8:28985624-28985646
Sequence GGCAGTGATCTGAGTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038604498_1038604500 3 Left 1038604498 8:28985624-28985646 CCAGCTGTACTCAGATCACTGCC 0: 1
1: 0
2: 2
3: 28
4: 144
Right 1038604500 8:28985650-28985672 TTAACTTATCTTTAAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038604498 Original CRISPR GGCAGTGATCTGAGTACAGC TGG (reversed) Intronic
900975633 1:6014574-6014596 GGCAGAGAGCCGAGGACAGCTGG - Intronic
901119921 1:6882954-6882976 GGCAGTGAGCTGAGACCAGAGGG - Intronic
901237909 1:7677375-7677397 GGGAGTGATCACAGGACAGCTGG + Intronic
901863851 1:12091225-12091247 GGCAATGATCTGAGTACAGTTGG + Intronic
903445624 1:23420894-23420916 GGAACTGATCTCAGGACAGCAGG - Intronic
905961895 1:42050023-42050045 GGCAGAGAACCGAGAACAGCCGG - Intergenic
906282542 1:44564228-44564250 GGCAGTGATCTGAATAAGGGTGG - Intronic
907118020 1:51986756-51986778 GGCAGAGAGCTGAGTTCAGTTGG + Intronic
911356478 1:96827209-96827231 GGCAGTGATCTGAGTGCACTTGG - Intergenic
918839315 1:189513616-189513638 GGCACTGACCTGATTCCAGCAGG - Intergenic
921186341 1:212672907-212672929 GGTAGTGTTCTGAGGACAGCTGG + Intergenic
922035203 1:221840953-221840975 GGCAGTGATCTGAGTGCTGAGGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923514409 1:234682342-234682364 GGCAGAGATCTGAGTGCTTCTGG - Intergenic
924205467 1:241707209-241707231 GGCAGTGTTGGGCGTACAGCTGG + Intronic
1063075625 10:2713493-2713515 GGCAGAGATTTGACTACAGGGGG - Intergenic
1063460930 10:6214721-6214743 GGCACTGAGCTGGGCACAGCGGG - Intronic
1068121497 10:52785832-52785854 GGGAGTGATCTGAGGAAAGCTGG - Intergenic
1074602950 10:114934018-114934040 GCCAGAGATCTGAGAACACCTGG + Intergenic
1075638025 10:124043638-124043660 AACAGTGATCTGAGGACCGCAGG + Intronic
1077439480 11:2561386-2561408 GGCAGGGTCCTGAGTACAGGTGG - Intronic
1077609569 11:3636043-3636065 GGCAGTGATCAGAGGAAGGCTGG + Intergenic
1077773764 11:5249285-5249307 AGTATTGATCTGAGCACAGCAGG - Intronic
1077774270 11:5254209-5254231 AGTATTGATCTGAGCACAGCAGG - Intronic
1078632393 11:13014874-13014896 GTCAATGATCTGAGAACAGAAGG + Intergenic
1079755332 11:24252156-24252178 GGCAGTGATTGGAGTAAAGGGGG + Intergenic
1082100546 11:48169636-48169658 GGCAGTGATGTGGGCAGAGCAGG - Intronic
1082916518 11:58444122-58444144 GGCAGTGTTCTCTGTAGAGCAGG - Intergenic
1090717363 11:129442297-129442319 TGGAGTGATCAGAGAACAGCAGG + Intronic
1091053602 11:132397545-132397567 GGCAGTCATCAGAATACAGATGG - Intergenic
1091116924 11:133021938-133021960 TGCAGTGATCTGAATACACATGG + Intronic
1091186249 11:133650282-133650304 GGCAGTGATTTGAGAGCAGGAGG - Intergenic
1091710750 12:2738326-2738348 GGCACTGAGCTGAGCACAGATGG + Intergenic
1094548359 12:31426795-31426817 ATCAGTGATCTGAGAACAGCTGG - Intronic
1094626288 12:32127393-32127415 GCCAGTGATCTCAGTACCACAGG + Intronic
1097158315 12:57028455-57028477 GGCAGGGGTCTAAGTACACCTGG + Intronic
1097877315 12:64655357-64655379 GGCAGGAATCTGCGTAAAGCAGG + Intronic
1100872441 12:98924125-98924147 GGCAGAGGTCTGATTAAAGCAGG + Intronic
1101954578 12:109201874-109201896 GAGAGGGATCTGAGTAAAGCAGG - Intronic
1104600269 12:130148600-130148622 GGCAGACATCTGAGCAGAGCTGG - Intergenic
1105026657 12:132853531-132853553 GGCAGTGTCCTGAGTACAGAAGG - Exonic
1107717748 13:43217211-43217233 GGCAGGCATCTGTGTACAGGAGG + Intronic
1109887293 13:68558647-68558669 GGTATTCATCTAAGTACAGCAGG - Intergenic
1112439069 13:99412452-99412474 TGCAGTGCTCTGTGCACAGCAGG + Intergenic
1115769692 14:36656564-36656586 GGCTCTGATCAGAGTACAGCGGG + Intergenic
1116465304 14:45224899-45224921 GGCAGTGGTCTGAATAGACCTGG - Intronic
1117499276 14:56336201-56336223 GCCAGTGATCTGAGAACAAAAGG + Intergenic
1117499618 14:56338972-56338994 GCCAGTGATCTGAGAACAAAAGG - Intergenic
1119950292 14:78737843-78737865 GGCAGTGACCTGGGTATAGTAGG + Intronic
1121323082 14:93004089-93004111 GGGTGTGCTCTGAGGACAGCAGG - Intronic
1122814417 14:104305422-104305444 GTCAGTGAACTGAGTCCAGCAGG - Intergenic
1123665561 15:22607731-22607753 GGCAGGGATCTGAGCACAGTGGG + Intergenic
1123752195 15:23364921-23364943 GGCAGGGATCTGAGCACAGTGGG - Intronic
1124069820 15:26380930-26380952 GGCAGTGATCTGTCCACAGATGG + Intergenic
1124269181 15:28265533-28265555 GGAAGTGAGATGAGTACAGTGGG - Intronic
1124319392 15:28702145-28702167 GGCAGGGATCTGAGCACAGTGGG + Intronic
1124483127 15:30093286-30093308 GGCAGGGATCTGAGCACAGTGGG - Intronic
1124489576 15:30145354-30145376 GGCAGGGATCTGAGCACAGTGGG - Intronic
1124520454 15:30403931-30403953 GGCGGGGATCTGAGCACAGTGGG + Intronic
1124538203 15:30562288-30562310 GGCGGGGATCTGAGCACAGTGGG - Intronic
1124544668 15:30614348-30614370 GGCAGGGATCTGAGCACAGTGGG - Intronic
1124564628 15:30801778-30801800 GGCGGGGATCTGAGCACAGTGGG - Intergenic
1124753951 15:32392973-32392995 GGCAGGGATCTGAGCACAGTGGG + Intronic
1124760450 15:32445297-32445319 GGCGGGGATCTGAGCACAGTGGG + Intronic
1124778186 15:32603765-32603787 GGCGGGGATCTGAGCACAGTGGG - Intronic
1125167557 15:36726164-36726186 TGCAGTGATATGAGTAAAACAGG - Intronic
1128601385 15:68998228-68998250 GGCAGAGATCTGAGTTGGGCAGG - Intronic
1128687820 15:69699846-69699868 GGCAGTGATCCAGGTAGAGCAGG - Intergenic
1130207430 15:81890104-81890126 GGGAAATATCTGAGTACAGCGGG - Intergenic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1132152544 15:99472981-99473003 GGCAGGGGTCTGACAACAGCAGG - Intergenic
1132837007 16:1959225-1959247 GGCACTGTGCTGAGTGCAGCAGG - Intergenic
1139000251 16:62501162-62501184 AGGAATGATCTGTGTACAGCAGG - Intergenic
1139494093 16:67303378-67303400 GCCAGGGATCTGATTCCAGCAGG + Intronic
1141441300 16:84031378-84031400 GGCAGTGTTTTGAGTACAGCAGG - Intronic
1142206923 16:88787709-88787731 GGCAGTGAACTGGGCACAGGTGG - Intergenic
1142380615 16:89729939-89729961 GGGAGTGTTCTGGGTACTGCTGG - Intronic
1143919002 17:10315867-10315889 GGCAGGGCTCTGGGTCCAGCCGG - Intronic
1143963545 17:10739477-10739499 GGCAGTGCTCTGAGTACGCAGGG - Intergenic
1144453241 17:15398516-15398538 GGCGGTGAGCTGAGTCCTGCAGG - Intergenic
1153528300 18:6018178-6018200 GGCAGAGTCCTGAGTGCAGCAGG + Intronic
1155429906 18:25744181-25744203 GGCACTGACCTGATGACAGCTGG - Intergenic
1158047079 18:53169183-53169205 GGGACTGATCTCAGTAAAGCAGG + Intronic
1160406633 18:78651115-78651137 GGCACTGATCTGAGGAGAACAGG - Intergenic
1160747197 19:717695-717717 GGCAGTGATCAGATGACAGGTGG + Intronic
1163263518 19:16205201-16205223 GGCTGTGGTCTGAGCTCAGCAGG + Intronic
1163760683 19:19134866-19134888 GGCGGTCCTCGGAGTACAGCTGG - Exonic
1166621872 19:44308603-44308625 GCCAGTGCGCTGAGGACAGCAGG + Intergenic
1167301089 19:48678083-48678105 GCCAGTGGTCTGATCACAGCTGG - Intergenic
1168152945 19:54458740-54458762 GGCAGTGAGCTGGGAACAGTGGG - Intronic
925683819 2:6450773-6450795 GGCAGTGATTTGAGATCAGAAGG - Intergenic
926884295 2:17583322-17583344 GGCCCTTATCTGAGAACAGCAGG - Intronic
928393110 2:30924338-30924360 GGCAGTGTTCTGAGAATGGCAGG + Intronic
928842238 2:35623930-35623952 AGCACTGATCAGAGTACAACTGG + Intergenic
930341732 2:50124616-50124638 GGAAGGGAACTGAGCACAGCAGG - Intronic
932692000 2:73921268-73921290 AGAAGTGCTCTGAGGACAGCTGG + Intergenic
936277614 2:111114158-111114180 TGCAGTCATCTGAGTTCAACAGG + Intronic
937052897 2:118906767-118906789 GGCAGGGATGTTAATACAGCAGG + Intergenic
937430876 2:121837008-121837030 GCCTGTGATCTGAGTTCAGGCGG + Intergenic
939377087 2:141382385-141382407 GGCAGTTCTCTGAGTGTAGCAGG - Intronic
939465734 2:142553425-142553447 GTGATTGAGCTGAGTACAGCTGG - Intergenic
941692359 2:168514246-168514268 TGTAGTCATCTGAGTACTGCTGG + Intronic
942875427 2:180790063-180790085 GGCTGGAATCTGAGTACAGAGGG - Intergenic
948156429 2:235787058-235787080 GGCAGTGCTCAGAGTCGAGCTGG + Intronic
1171310889 20:24143839-24143861 GGCAGGAATCTGGGTTCAGCAGG - Intergenic
1171511215 20:25686196-25686218 AGTAGTGATCTGTGTACAGATGG - Intronic
1174980175 20:55385256-55385278 GCCAGTGATCTTAGGACAGGAGG + Intergenic
1178883162 21:36464567-36464589 GGCAGTGAGCATAGGACAGCCGG - Intronic
1179274792 21:39882406-39882428 GGCTTTTATCTGAGTACACCCGG + Intronic
1179531683 21:42023767-42023789 GGCAGTGATTGGAGCACGGCTGG - Intergenic
1182510129 22:30813744-30813766 GGCAGTGGTGTGGGGACAGCTGG + Intronic
1182575222 22:31268360-31268382 GGCTGTGAACTGAGAACAGTTGG - Intronic
1183002299 22:34871220-34871242 GAGAGTTAGCTGAGTACAGCAGG + Intergenic
1183681658 22:39334140-39334162 GGTCTTGATCTGAGTACAGGAGG + Intergenic
1185071964 22:48661555-48661577 GGCACTGATCAGTGTCCAGCAGG - Intronic
1185359903 22:50399807-50399829 GGCAGTGCTCTGACTCCAGAAGG - Intronic
1185397993 22:50602170-50602192 GGGAGTGATCTGAGGACAGAGGG - Intronic
950522512 3:13505373-13505395 GGCAGTGATCTGGGCGCCGCAGG - Exonic
954525828 3:51270360-51270382 GGCTGTGAGCAGAGTTCAGCTGG + Intronic
958119120 3:89262150-89262172 GACAGTGATCTGTGAACAGTTGG - Intronic
962742553 3:138372504-138372526 GGCAGTGGTCTGAGCAGGGCTGG - Intronic
963347757 3:144116179-144116201 GGCAGTGACCTGAGAGCTGCTGG + Intergenic
963796947 3:149640177-149640199 GGCATTTATCTGAATACAGTGGG - Intronic
964741567 3:159971579-159971601 GGCTGTGATCCAAGTACGGCGGG - Intergenic
966322816 3:178719857-178719879 GGCAGAGATTTGAATACAGCAGG - Intronic
967705536 3:192645644-192645666 GGCAGTCATCAGAGTACAGGTGG + Intronic
968261474 3:197328376-197328398 GGCAGTGAACTGAGGATGGCAGG - Intergenic
968888264 4:3348823-3348845 GGCAGTGATATGCGGCCAGCAGG + Intronic
970185280 4:13445743-13445765 GGCATTGACCTGATTCCAGCTGG + Intronic
973876992 4:55229972-55229994 GGGAGTGATCTGAGGAAAGTTGG + Intergenic
974908213 4:68082920-68082942 CCCAGTGATCTGGGTACAGAAGG + Intronic
985250534 4:188020435-188020457 TGCAGTGAGCTGAGAACAGCTGG - Intergenic
985351848 4:189072129-189072151 GGCAGTTATCACAGCACAGCTGG - Intergenic
986151496 5:5133966-5133988 AGCAGTCATGTGGGTACAGCAGG + Intergenic
986366294 5:7035569-7035591 GGCAGTGGGCTGAGTACTGTGGG + Intergenic
987386979 5:17339172-17339194 GGCAGTGATCTGGAGACAGGGGG + Intergenic
1002904483 6:1437832-1437854 GGCAGTGATCTCAGTTGGGCAGG + Intergenic
1005221021 6:23588734-23588756 GGCAATGATGTGAGTAGAGGAGG + Intergenic
1007480339 6:42145624-42145646 GGCAGTGACCTGTGGAGAGCTGG + Intergenic
1014031589 6:116711830-116711852 GGCAGGGATTTGAGACCAGCCGG - Intronic
1014440230 6:121465372-121465394 GGCAGGGAGGTGAGTACAGCAGG + Intergenic
1014787198 6:125632642-125632664 CGCAGTGATCTCAGAAAAGCAGG - Intergenic
1016874939 6:148855346-148855368 GGCAGTGATCTGAGAACAAAAGG - Intronic
1017847767 6:158274368-158274390 TGCAGTGATCCGGGTACAGCTGG - Intronic
1018039071 6:159905573-159905595 AGCTGTGATCTCAGTACAGCCGG - Intergenic
1019388478 7:772097-772119 AGCAGGGACCTGCGTACAGCCGG - Intronic
1019411144 7:907311-907333 GGCAGAGATATGAGGACAGGAGG + Intronic
1021317248 7:19164017-19164039 GGCAGTGATCAGATTACTGGAGG - Intergenic
1022482490 7:30753041-30753063 GGCAGAAATCAGAGAACAGCCGG + Intronic
1022495889 7:30852976-30852998 GGCTGTGTCCTGAGTTCAGCAGG - Intronic
1023587463 7:41745426-41745448 GCCAGTGCACTGAGAACAGCAGG + Intergenic
1024022664 7:45386079-45386101 GGCAGTGAGCTGCATCCAGCTGG - Intergenic
1026108454 7:67439235-67439257 GGCTGTGCTCTGAATCCAGCAGG - Intergenic
1028273604 7:88823629-88823651 TGCAGTGAGCTGAGTACAATTGG + Intronic
1028523070 7:91753171-91753193 GGCACTGATCTGATGCCAGCAGG - Intronic
1029068953 7:97879567-97879589 GGCAGGAAGCTGAGGACAGCAGG + Intergenic
1031237622 7:119196968-119196990 AGCAGAGATCATAGTACAGCAGG + Intergenic
1032487954 7:132302388-132302410 GGGATTGCACTGAGTACAGCAGG - Intronic
1032716681 7:134514698-134514720 AGCTGTGATCTGAATACAGCAGG + Intergenic
1035759713 8:2060881-2060903 GGCTCAGCTCTGAGTACAGCAGG + Intronic
1038604498 8:28985624-28985646 GGCAGTGATCTGAGTACAGCTGG - Intronic
1047148835 8:122237643-122237665 GGTAGTAACCTGTGTACAGCAGG + Intergenic
1048365150 8:133732024-133732046 GGCAGGGAGCTGAGTAGAGCTGG - Intergenic
1049048255 8:140170174-140170196 GGCAGTGGGGTGAGGACAGCTGG + Intronic
1049274022 8:141710842-141710864 GGCAGGGAACTGAGCACAGCAGG - Intergenic
1049311095 8:141934293-141934315 GGCAGTGAGGGGAGCACAGCAGG - Intergenic
1049654372 8:143791329-143791351 GGCAGTGAGCTGAGGGCAGCTGG + Intronic
1049794955 8:144493028-144493050 GGCAGTGATGGGAGTAGAGAGGG + Intronic
1051118491 9:13725418-13725440 GGAAGAGATGTGAGGACAGCAGG - Intergenic
1061649279 9:132033614-132033636 GGCAGAGATCTCAGAACAGTTGG - Intronic
1186758674 X:12700424-12700446 GGCAGTGAGCTAAGTGCTGCTGG - Intronic
1186790623 X:12994558-12994580 GGCAGTGATCTGAATATGGCTGG + Intergenic
1199969108 X:152845622-152845644 AGAAGTGATCAGAGTACAGTGGG - Intronic
1200691326 Y:6307952-6307974 GGCAATGTTCTGCCTACAGCTGG - Intergenic
1201043946 Y:9866764-9866786 GGCAATGTTCTGCCTACAGCTGG + Intergenic