ID: 1038609734

View in Genome Browser
Species Human (GRCh38)
Location 8:29049305-29049327
Sequence CGCAATGGGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 1, 2: 7, 3: 85, 4: 800}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038609723_1038609734 20 Left 1038609723 8:29049262-29049284 CCCACATGGATTTATTGTCATAC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG 0: 1
1: 1
2: 7
3: 85
4: 800
1038609724_1038609734 19 Left 1038609724 8:29049263-29049285 CCACATGGATTTATTGTCATACA 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG 0: 1
1: 1
2: 7
3: 85
4: 800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038609734 Original CRISPR CGCAATGGGGAGGAGGAGGA GGG Intronic
900029296 1:359295-359317 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900049898 1:588067-588089 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900410181 1:2509059-2509081 GGCTTTGGGGAGGAAGAGGACGG + Exonic
900526521 1:3131864-3131886 CCCAGGAGGGAGGAGGAGGAAGG - Intronic
900554534 1:3273134-3273156 GGCAGTGGGGAGCAGGAGCAGGG + Intronic
900620164 1:3583092-3583114 TGCAAGGGGACGGAGGAGGAGGG + Intronic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
900857707 1:5199291-5199313 CGGATTGGGGATGAGGAAGATGG - Intergenic
901459749 1:9384453-9384475 GGCATGGGAGAGGAGGAGGAGGG - Intergenic
902037718 1:13469712-13469734 GACATTGGGGAGGAGGGGGAGGG + Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902557322 1:17254622-17254644 TTCAATGGTGAGGAGGAAGACGG - Intronic
903222467 1:21876401-21876423 TGCAACTGGGAGGAGGAGAAAGG + Exonic
903334187 1:22614017-22614039 TGTGAGGGGGAGGAGGAGGAGGG + Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903571141 1:24306376-24306398 CCCAATGGGGAAGAGAAAGAAGG + Intergenic
903835615 1:26201525-26201547 CCCATTGGGTAGGAGAAGGAAGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904323339 1:29710816-29710838 GGCAGTGGGGAGGAAGAAGATGG - Intergenic
904365956 1:30010934-30010956 AGACATGGGGAGGAGGCGGACGG - Intergenic
904490630 1:30856932-30856954 TGCAATGGGGAGAATAAGGACGG - Intergenic
904686816 1:32266682-32266704 GGGGATGGGGAGGAGGGGGAAGG - Intronic
905297432 1:36963055-36963077 TGGAAGGGGGAGGAGAAGGAAGG + Intronic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905617389 1:39410320-39410342 GGGAAAGGAGAGGAGGAGGATGG + Intronic
905731048 1:40299787-40299809 GGCAGTGGGGAGGAGGAGGAGGG + Intergenic
906473755 1:46152807-46152829 AGCACTGGGGAGGCCGAGGAGGG - Intronic
906544446 1:46611589-46611611 GGGAATGGTGAGGAAGAGGAGGG - Intronic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
907160990 1:52368704-52368726 GGCCATGAGGAGGAGCAGGAGGG - Intergenic
907278553 1:53330017-53330039 CACAGAGTGGAGGAGGAGGAGGG - Intergenic
907461158 1:54606397-54606419 GGGAGTGGGGAGGAGGAGGTGGG + Intronic
907744160 1:57196032-57196054 GGTGATGGGGAGTAGGAGGAAGG + Intronic
908061495 1:60354956-60354978 CAAAATGGGGTGGAGGGGGAGGG + Intergenic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908682573 1:66678715-66678737 CGGGAAGGGGAGGAGGAGGGAGG + Intronic
909458766 1:75883259-75883281 AGCATTTGGGAGGCGGAGGAGGG - Intronic
909760457 1:79279766-79279788 TGTGATGGGGTGGAGGAGGAGGG + Intergenic
910574658 1:88747092-88747114 TGAACTGGGGAGGGGGAGGATGG + Intronic
910693825 1:89991626-89991648 GGCAGTGGGGATGAAGAGGAGGG + Intergenic
912454479 1:109788502-109788524 GGCAATTGGAAGGAGGAGGCTGG - Intergenic
912703491 1:111895383-111895405 CCAAATGGGGAGGTGGGGGAAGG + Intronic
913046535 1:115078132-115078154 AGCTAGGGGGAGGCGGAGGAGGG - Intronic
913183576 1:116345917-116345939 GGGCATGGGTAGGAGGAGGAGGG + Intergenic
913286679 1:117233051-117233073 CGCAGAGGGAAGGAGGAGGAAGG - Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
915264169 1:154703670-154703692 TGCACTCTGGAGGAGGAGGAAGG + Exonic
915807755 1:158872439-158872461 TGCAGTGGGGGGGAGGGGGAAGG + Intergenic
915977460 1:160400546-160400568 CGCAGGGGGGAGGGGGCGGAGGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
917517778 1:175722212-175722234 CGATAGGGGAAGGAGGAGGAGGG - Intronic
917920781 1:179747937-179747959 GGAAAGGGGGAGGAGGGGGAGGG + Intronic
918383598 1:183983346-183983368 GACATTGGGGAGGAGGAGCAGGG - Intronic
918465732 1:184819616-184819638 CGCAATGGAGTGAAGGAGGCCGG + Intronic
918663070 1:187113763-187113785 GGAAATGGGGAGGAGGGCGAGGG - Intergenic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
919919532 1:202160033-202160055 GGGGATGGGCAGGAGGAGGAAGG - Intronic
920009378 1:202856803-202856825 CGCAATGGTAGGGATGAGGAAGG + Intergenic
920011528 1:202871464-202871486 TGCTATGTGGTGGAGGAGGATGG - Intergenic
920059784 1:203219347-203219369 AGCACTGGGGAGGAGGAGGGAGG + Intronic
920097624 1:203496852-203496874 GTCACTGTGGAGGAGGAGGAGGG - Intronic
920920747 1:210295395-210295417 CCCAAGGAGGAGGTGGAGGAAGG - Intergenic
921155119 1:212433103-212433125 CGCTATGGCGGGGAGGAGGTAGG + Exonic
921702636 1:218285050-218285072 CGCACTGGGGCGGAGGACCAGGG + Intergenic
921764918 1:218960267-218960289 CGGAAAGTGGAGGGGGAGGAGGG - Intergenic
921882683 1:220272383-220272405 CGCAGTGGGGTGGAGGGGGCAGG - Exonic
922067590 1:222158868-222158890 CTCAATGGGCAAGAGGAGAAGGG + Intergenic
922603195 1:226872109-226872131 AGCAAGGAGGAGGAGGAGCAAGG + Intronic
922723852 1:227913604-227913626 TGCAAGGCTGAGGAGGAGGAGGG + Intergenic
923141035 1:231162019-231162041 AGTAATGGGGAGGAGGGGGGAGG - Intergenic
923339795 1:232997606-232997628 TGCACTGGGGAGGAGGTGGTTGG - Intronic
923510768 1:234650503-234650525 AGCAGTGGGGAGGAAGAGGAGGG + Intergenic
923834168 1:237591223-237591245 CACAAAGAGGAGGAGGAGAAGGG - Intronic
924260978 1:242231230-242231252 CTCAACAGGGAGGAGGAAGAGGG - Intronic
1062824451 10:557751-557773 GGGAAGGGGGAGGGGGAGGATGG + Intronic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063281123 10:4630773-4630795 GGCAGTGAGGAAGAGGAGGAAGG - Intergenic
1063572801 10:7231762-7231784 CCCGAAGAGGAGGAGGAGGAGGG - Intronic
1063613226 10:7580706-7580728 CGCAGAGGGGAGGAGGGGCATGG + Intronic
1064515143 10:16139143-16139165 AGGAAAGGAGAGGAGGAGGAGGG - Intergenic
1065495353 10:26321842-26321864 GGAATTGGAGAGGAGGAGGATGG + Intergenic
1066081398 10:31934226-31934248 GATAAAGGGGAGGAGGAGGAAGG - Intergenic
1066390653 10:34975250-34975272 CTCAAAGGGGAGAATGAGGAGGG + Intergenic
1066453377 10:35551037-35551059 TGCACTGGGGAGGAAGAGGTTGG - Intronic
1066493516 10:35918199-35918221 GGCAATGGAGTAGAGGAGGAGGG + Intergenic
1067112400 10:43409383-43409405 GGGGAGGGGGAGGAGGAGGAGGG + Intergenic
1067469704 10:46527614-46527636 GGCAGCAGGGAGGAGGAGGATGG + Intergenic
1067561781 10:47309666-47309688 AGCAAAGCGGGGGAGGAGGATGG + Intronic
1067789742 10:49278647-49278669 AGCACTGGGGAGCAGGAGGGAGG + Intergenic
1069785840 10:70987506-70987528 GGCAGTGGGTAGGAGGGGGAAGG - Intergenic
1069846970 10:71378976-71378998 CCCAGTGAGGAGGAGGACGATGG + Intergenic
1070711863 10:78688986-78689008 GGAATGGGGGAGGAGGAGGAAGG - Intergenic
1070737875 10:78876887-78876909 GGCAATGGGAATGAGGAGGAAGG - Intergenic
1070824441 10:79382556-79382578 CGCATGGGGGCGGAGGAGGTCGG + Exonic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1071345092 10:84684919-84684941 CTCAATGGGGAGGAGAAAGTGGG - Intergenic
1071483377 10:86081018-86081040 GACAAGGGAGAGGAGGAGGATGG + Intronic
1071751139 10:88477464-88477486 GACAATGGGGAAGAGGATGATGG + Intronic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072427145 10:95339155-95339177 CGACTTGGGGAGGAGGAGAAAGG + Exonic
1072895720 10:99365021-99365043 TACGATGGGGAGGACGAGGAAGG - Intronic
1073632785 10:105165460-105165482 GGCAATGGGGATGATGATGATGG - Intronic
1074451982 10:113566872-113566894 GGCAATGGGAGGGAGGAGTATGG + Intronic
1074892409 10:117746587-117746609 GGCAATGGGAAGGAGGAAGAGGG + Intergenic
1074923771 10:118046701-118046723 GGCGAGGGGGAGGAGGAGGAGGG - Intergenic
1075093118 10:119454436-119454458 TGCAGAGGGGAGGAGGAGGGAGG - Intronic
1075106408 10:119542720-119542742 GGCGAGGAGGAGGAGGAGGAGGG + Intergenic
1075700603 10:124467234-124467256 GGCAATGGAGATGGGGAGGAAGG + Intronic
1076096082 10:127736229-127736251 CGCTGTGGGGTGGCGGAGGATGG - Intergenic
1076812790 10:132897994-132898016 CTCCAGTGGGAGGAGGAGGACGG - Intronic
1077031262 11:468988-469010 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031271 11:469020-469042 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031298 11:469116-469138 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031307 11:469148-469170 GGTAATTGGAAGGAGGAGGAGGG + Intronic
1077031331 11:469244-469266 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077210773 11:1370091-1370113 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1078140942 11:8692602-8692624 GGAGATGGGGAGGAGGAAGAGGG + Intronic
1078348851 11:10575973-10575995 GGCACGGGGGAGGAGGAGGTAGG - Exonic
1078357046 11:10640218-10640240 CTCACTGGGGAGGAGGACCATGG + Intronic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1078642470 11:13109294-13109316 AGCAATGGGAAGCAGCAGGAGGG + Intergenic
1079250034 11:18780519-18780541 CACAAAGAGGAGGAGCAGGAAGG - Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079810956 11:24999387-24999409 GAAGATGGGGAGGAGGAGGAAGG + Intronic
1081717742 11:45262917-45262939 GGGAATAGTGAGGAGGAGGAAGG - Intronic
1081761829 11:45582038-45582060 GACAAAGTGGAGGAGGAGGATGG + Intergenic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1083788890 11:64971473-64971495 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1084120893 11:67068366-67068388 CCCCAGGGAGAGGAGGAGGAGGG + Intronic
1084464608 11:69314860-69314882 GGCCTTGGGGAGGAGGAGTAAGG - Intronic
1084524375 11:69686692-69686714 CCTAATGGGGTGGAGGAGGCAGG - Intergenic
1084717291 11:70882159-70882181 AGCATGGAGGAGGAGGAGGAGGG + Intronic
1084739299 11:71128679-71128701 AGAGATGGGGAGGAGTAGGAGGG - Intronic
1084785735 11:71440672-71440694 GGCAATGGGTAGGTGGATGATGG + Intronic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085445239 11:76597057-76597079 TGGAATGGGGAGGTGGAGGTGGG - Intergenic
1085478813 11:76805261-76805283 CTCAGAGGGGAGGAGGTGGAGGG + Intergenic
1085561236 11:77474148-77474170 GGCAGAGGGGAGGAGGAGGCGGG - Intronic
1085808012 11:79654210-79654232 GACAGTGGGAAGGAGGAGGAAGG + Intergenic
1086035413 11:82409017-82409039 CTAAATGGTGAGGAGGAGGATGG + Intergenic
1086167150 11:83791854-83791876 CACAAGCTGGAGGAGGAGGAAGG - Intronic
1087665265 11:101038171-101038193 AGAAAGGGAGAGGAGGAGGAGGG - Exonic
1088913747 11:114211619-114211641 CCCAATGCGGGGGAGGGGGAAGG - Intronic
1089320146 11:117620357-117620379 AGGAGAGGGGAGGAGGAGGAGGG - Intronic
1089573039 11:119422752-119422774 CGCAGAGGCGGGGAGGAGGACGG - Intronic
1089746918 11:120623989-120624011 CGGAAAGGGGAGGAGGAAGAGGG - Intronic
1089920761 11:122207423-122207445 GGCAATGAGGAGGATGAGAATGG + Intergenic
1090056016 11:123425779-123425801 AGCAGTGTGGAGGAGGAGGCTGG - Intergenic
1090091110 11:123698815-123698837 CGGAATGGGGAAGGGAAGGAGGG + Intergenic
1090336892 11:125974975-125974997 GGGAATGGGGATGAAGAGGAAGG - Intronic
1090588850 11:128243332-128243354 AGCAATGGGAGGGAGGAGAATGG - Intergenic
1090972709 11:131656667-131656689 AGAGCTGGGGAGGAGGAGGAAGG + Intronic
1091232449 11:133997564-133997586 TGGAATGGGGAGGAAGAAGAGGG - Intergenic
1091364307 11:135004976-135004998 AGCAGAGGGGAGAAGGAGGAAGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091558547 12:1594063-1594085 CGGAGGGGGGAGGAGGAAGATGG - Exonic
1091568144 12:1662600-1662622 GGAAGTGGGGAGGAGGAGGCGGG - Intergenic
1091596542 12:1882566-1882588 AGGACTGTGGAGGAGGAGGAAGG + Intronic
1091676352 12:2493454-2493476 GACCATGGGGAGGAGGAGAAAGG - Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1091832308 12:3558248-3558270 GGGAAAGGGGAGGAGAAGGAAGG - Intronic
1091880613 12:3974481-3974503 AGAAAGGGGGAGGAGAAGGAAGG - Intergenic
1092161872 12:6319503-6319525 CGCAGAGGGGAGGAGGAGAGAGG + Intronic
1092658935 12:10718303-10718325 GGCAATGTGGAGGAGGAAGGTGG - Intronic
1092843337 12:12562943-12562965 CGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1092861527 12:12724101-12724123 CGCAGAGGAGAGGAGGAGGGAGG - Intergenic
1092983424 12:13820761-13820783 AGCAGTGGGGAAAAGGAGGAAGG - Intronic
1093469325 12:19483610-19483632 TACAATCGGGAGGAGGAAGATGG - Intronic
1094508327 12:31080340-31080362 GGCAAGAGGGAGGGGGAGGAGGG - Intronic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096134246 12:49186481-49186503 AGCAGGGGGGAGGAGGAGGAGGG + Intronic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096785157 12:54013110-54013132 CCCAAGGCTGAGGAGGAGGAGGG - Intronic
1097057936 12:56261202-56261224 GGCAATTGGAGGGAGGAGGACGG + Intergenic
1097279271 12:57834525-57834547 GACAATGGGGCAGAGGAGGAAGG + Intronic
1097823099 12:64147361-64147383 AGGAATTGGGAGGAGGAGGTGGG - Exonic
1098275067 12:68804805-68804827 CACAGTGGGAAGGAGGAGAAGGG + Intergenic
1098948169 12:76610607-76610629 GACAAAGAGGAGGAGGAGGAGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1101108979 12:101467335-101467357 CCCAATGGGGACGATGAGAATGG + Intergenic
1101843104 12:108341944-108341966 GGGGAGGGGGAGGAGGAGGAGGG + Intergenic
1101920204 12:108926165-108926187 AGCAATTGGGAGGGCGAGGAGGG - Intronic
1102230371 12:111257649-111257671 GGGAAGAGGGAGGAGGAGGAAGG - Intronic
1102445178 12:112996759-112996781 AGCAGGAGGGAGGAGGAGGATGG + Intronic
1102998141 12:117365157-117365179 AGCCCTGGGCAGGAGGAGGAAGG + Intronic
1103080909 12:118023392-118023414 GGGAAGGGGGAGGAGGAGGAGGG + Intronic
1103449714 12:121020072-121020094 TGCCAGGGGGAGGATGAGGAGGG - Intergenic
1103623189 12:122201026-122201048 CGGGATGGGGAGGAGGTGGTGGG + Intronic
1103721154 12:122976279-122976301 CTCCAGGGGAAGGAGGAGGAGGG - Exonic
1103987990 12:124780112-124780134 GGCAAAGAGGAGGAGGAGGAGGG - Intronic
1104079248 12:125415706-125415728 CGCAGTGGGGAGGAGGGGAGTGG + Intronic
1104749901 12:131231765-131231787 GGCGGAGGGGAGGAGGAGGAGGG - Intergenic
1104759546 12:131288757-131288779 CGCCCTGGGGAGAGGGAGGAGGG + Intergenic
1104821167 12:131678455-131678477 CGCCCTGGGGAGAGGGAGGAGGG - Intergenic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1105988531 13:25593675-25593697 AGGAATGGGTAGGAGGAGGGAGG + Intronic
1106512232 13:30421884-30421906 AGCGGGGGGGAGGAGGAGGAAGG + Intergenic
1106628015 13:31441109-31441131 AGAAGTGGGGAGGATGAGGACGG + Intergenic
1108392068 13:49956288-49956310 AGAAAGGAGGAGGAGGAGGAAGG - Intergenic
1108596193 13:51951692-51951714 GGGGATGAGGAGGAGGAGGAGGG + Intronic
1110248548 13:73355655-73355677 CTCACTGGGGAAGAGCAGGATGG - Intergenic
1110515853 13:76411474-76411496 GGGAGGGGGGAGGAGGAGGAGGG + Intergenic
1110975479 13:81828564-81828586 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1111086412 13:83380683-83380705 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1111975205 13:94959758-94959780 GGTAATGGGGAAAAGGAGGACGG - Intergenic
1113260430 13:108555742-108555764 TGGTAAGGGGAGGAGGAGGAGGG - Intergenic
1113330154 13:109319140-109319162 CCCATTGGGGAGGGGGAGGTGGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113813252 13:113154391-113154413 GGCGCGGGGGAGGAGGAGGAAGG + Intergenic
1113909920 13:113836842-113836864 GGGAGTGGGGGGGAGGAGGAGGG + Intronic
1114458492 14:22872317-22872339 ACCAAGGAGGAGGAGGAGGAGGG - Exonic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1115147208 14:30239480-30239502 AGCAGAGGGGTGGAGGAGGAAGG - Intergenic
1115186424 14:30693338-30693360 AGAAATGGGGTGGAAGAGGACGG + Intronic
1116055220 14:39855453-39855475 AGTGATGAGGAGGAGGAGGAAGG - Intergenic
1116081911 14:40185586-40185608 GGGAATGGGGAGGATGATGATGG - Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117362550 14:54991346-54991368 CTCAAAGAGGAGGAGGAAGATGG - Exonic
1117898388 14:60510001-60510023 CGCACCGGGGAGGAGGCGGGTGG + Intronic
1118701229 14:68435175-68435197 CTAGATGGGGAAGAGGAGGATGG - Intronic
1119004399 14:70910124-70910146 GGGGAGGGGGAGGAGGAGGAGGG - Intronic
1119019569 14:71096985-71097007 CGGGGTGGGGAGGAGGAGGGAGG - Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119328815 14:73778658-73778680 TGCAATGGGGAGGCTGAGGAGGG + Intronic
1119635478 14:76269852-76269874 CGCATTGTGGAGAGGGAGGAAGG - Intergenic
1119688769 14:76654326-76654348 CCCAAAGGGGAGGAGGTGGTGGG - Intergenic
1120470520 14:84918064-84918086 TGCCAAGAGGAGGAGGAGGAAGG - Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1121022182 14:90587013-90587035 CTCAATGGAGATGAAGAGGAGGG - Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121898169 14:97668219-97668241 CTCTATGGGGAGGATGAAGAGGG - Intergenic
1121938008 14:98038219-98038241 GGCATTAGGGAGGAGAAGGAGGG + Intergenic
1122068108 14:99187776-99187798 CTCCAGGAGGAGGAGGAGGAAGG - Intronic
1122249333 14:100427097-100427119 AGCAGAGAGGAGGAGGAGGAGGG - Intronic
1122782644 14:104150146-104150168 GGGAAGGGGGAGGAGGAGGAGGG - Intronic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1124186130 15:27531104-27531126 AGGATTGTGGAGGAGGAGGAGGG + Intronic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1125024800 15:35019487-35019509 AGGGAGGGGGAGGAGGAGGAAGG - Intergenic
1125024808 15:35019506-35019528 AGGGAGGGGGAGGAGGAGGAGGG - Intergenic
1125933948 15:43618618-43618640 AGAACTGGGGATGAGGAGGAGGG - Intronic
1125947045 15:43718080-43718102 AGAACTGGGGATGAGGAGGAGGG - Intergenic
1126303803 15:47231091-47231113 GGCAAAGAGGAGGAGGAAGAGGG - Intronic
1126411110 15:48374101-48374123 AGAAATGGGGAGGAGGAGGGAGG - Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127282122 15:57501593-57501615 AGAAGTGGGGAGCAGGAGGAGGG + Intronic
1128106396 15:65048657-65048679 TGTCTTGGGGAGGAGGAGGAAGG - Intronic
1128441029 15:67708679-67708701 GGCAATGGGCAGGAGGAAGAAGG - Intronic
1128547023 15:68575206-68575228 AACAATGGGGAAGAGGAGGGTGG + Intergenic
1128940885 15:71786790-71786812 GGAAGAGGGGAGGAGGAGGAGGG + Intergenic
1129233178 15:74208091-74208113 GACACTGGTGAGGAGGAGGAGGG + Intronic
1129268443 15:74407315-74407337 CTCGTTGGGGAGGAGGAAGAGGG - Intergenic
1129524979 15:76208106-76208128 TGGAATGGGTAGGAGGGGGAAGG + Intronic
1129680454 15:77655854-77655876 AGCAATGGGGAGGAGAAGGCTGG - Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1129816698 15:78561690-78561712 GGCAAGGCAGAGGAGGAGGAGGG + Intergenic
1130612511 15:85374201-85374223 CTCAAGGGGGAAGTGGAGGAGGG + Intergenic
1130721026 15:86386096-86386118 GGGAGAGGGGAGGAGGAGGAGGG - Intronic
1130744361 15:86635262-86635284 GGGAAGGAGGAGGAGGAGGAGGG - Intronic
1131284707 15:91047766-91047788 AGCAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132055688 15:98649027-98649049 AGCCAGGAGGAGGAGGAGGAGGG + Exonic
1132695654 16:1200657-1200679 GGGCACGGGGAGGAGGAGGAGGG + Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133460739 16:5984154-5984176 GGGGAAGGGGAGGAGGAGGAGGG - Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134290713 16:12901560-12901582 GGGAAGGGGGAGGGGGAGGAGGG - Intergenic
1134487463 16:14669902-14669924 GGCCATGGGGTGGAGGTGGATGG - Intergenic
1135046270 16:19158527-19158549 CCCAAAAGGGAGGAGAAGGAAGG + Intronic
1135529026 16:23236678-23236700 CGCATGGGGGAGGAGAGGGATGG + Intergenic
1135565642 16:23509430-23509452 GGGATTGGCGAGGAGGAGGAGGG - Intronic
1135616972 16:23919668-23919690 GGCCATGGGGTGGAGGAAGAGGG - Intronic
1135724044 16:24840921-24840943 AGAAAAGAGGAGGAGGAGGAGGG + Intergenic
1136012323 16:27371889-27371911 TGGAATGGGGAGGATGAGTAGGG - Intergenic
1136502330 16:30678314-30678336 CCCACTGGGAATGAGGAGGAGGG + Intergenic
1136679080 16:31944520-31944542 CCAAATGGTGAGGAGGTGGAAGG + Intergenic
1137426339 16:48384716-48384738 CGCCGCGGGGAGGAGGGGGAGGG + Intronic
1138229007 16:55324297-55324319 GGCAAGAGGGAGAAGGAGGAGGG - Exonic
1139353252 16:66351128-66351150 GGCAAGGGGGACCAGGAGGAAGG + Intergenic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139944174 16:70627448-70627470 GGGAAGGGGGAGGAGGGGGAGGG - Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140519158 16:75566766-75566788 CGCAGGGCGCAGGAGGAGGAGGG + Intronic
1140655139 16:77132368-77132390 GGGGATGGGGAGGGGGAGGAGGG - Intergenic
1140704609 16:77615034-77615056 AGAAAGGAGGAGGAGGAGGAAGG + Intergenic
1141382024 16:83585329-83585351 GGCAGTGGGGATGAGGAGGTTGG + Intronic
1142141707 16:88475533-88475555 AGAAAAAGGGAGGAGGAGGAGGG + Intronic
1142187005 16:88699386-88699408 AGCTGTGGGGAGCAGGAGGAGGG - Intronic
1142304577 16:89278302-89278324 CCCAGTGGGTAGGAGGAGGTGGG + Intronic
1203141916 16_KI270728v1_random:1772300-1772322 TGCAAGGGGGAGGAGGAGGGAGG - Intergenic
1142766108 17:2065199-2065221 CGCCATGTGGAGGAGGAGGAGGG + Intronic
1142885441 17:2909689-2909711 AACACGGGGGAGGAGGAGGAAGG - Intronic
1142964003 17:3569639-3569661 AGCACAGGGGAAGAGGAGGAAGG + Intronic
1142996319 17:3762467-3762489 GACAGTGGGGAGGACGAGGAAGG - Intronic
1143296639 17:5876273-5876295 GGGGATGGGGAGGAGGGGGAAGG + Intronic
1143448408 17:7022030-7022052 CGCAAAGGGGAGGAGGCTAAAGG + Intergenic
1143747652 17:9005454-9005476 AGCGGTGGGGAGGAGGAGGGAGG - Intergenic
1144287126 17:13787636-13787658 CGCAATGGAGAGGAAGAGGATGG + Intergenic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144715516 17:17432768-17432790 CGTGTTGGGGACGAGGAGGAAGG - Intergenic
1144771637 17:17762807-17762829 TGCAGTGGGGAGGGGGAGGCGGG - Intronic
1144879754 17:18425247-18425269 ACCAGAGGGGAGGAGGAGGAAGG + Intergenic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145152480 17:20519137-20519159 ACCAGAGGGGAGGAGGAGGAAGG - Intergenic
1145331082 17:21872740-21872762 TGCAATGGAAAGGAAGAGGATGG + Intergenic
1145774265 17:27516518-27516540 TGAAAGGGGGAGGAGGAGGAGGG - Intronic
1145868615 17:28256321-28256343 CGCTGGGGGGAGGAGGAGGCTGG - Intergenic
1146762411 17:35490077-35490099 GGCACTGGGGAGGAGGGGGCCGG - Intronic
1146950283 17:36900602-36900624 CTCAGAGGGGAGGAAGAGGAAGG + Intergenic
1147315222 17:39617170-39617192 CGCAATGGAGAGGGAAAGGAGGG + Intergenic
1147765622 17:42833729-42833751 CGCCATGGGGAGTAGGAAGCCGG - Intronic
1147945259 17:44077127-44077149 GGTACTGGGGAGGAGGAGGAAGG + Exonic
1148186844 17:45650551-45650573 GGCGCTGGGGAGGGGGAGGATGG + Intergenic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148429964 17:47634732-47634754 AGCAATGGGGAGGTGGAGGTGGG + Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150781917 17:68130466-68130488 GGCAATGGGAAGGAGGACAAAGG + Intergenic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1150951789 17:69810666-69810688 CGCAATGGGGCGGGGGCGGGGGG + Intergenic
1151155480 17:72121158-72121180 CGAATTGGAGAGGAGGAGGAGGG - Exonic
1151232646 17:72695740-72695762 CACAGAGGAGAGGAGGAGGAAGG + Intronic
1151239108 17:72744029-72744051 GGCAATGGGGAGGTGGAGAGAGG - Intronic
1151307507 17:73272717-73272739 CCCCATGGGGAGGAGGAGAGAGG + Intergenic
1151361709 17:73593100-73593122 TGGGGTGGGGAGGAGGAGGAGGG - Intronic
1151559043 17:74861100-74861122 CGCCAAGCGAAGGAGGAGGAGGG + Intronic
1151860835 17:76760370-76760392 CACATTGAGAAGGAGGAGGAGGG + Intronic
1151990629 17:77571785-77571807 GGCATCGGGGAGGAGGGGGAAGG + Intergenic
1152002582 17:77655806-77655828 GACAATGGGGAGGAGAGGGATGG - Intergenic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152376573 17:79921718-79921740 CGCAAAAGGGAGGAGCTGGAGGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152540042 17:80970258-80970280 CCCAAGGTGGAGGAGGGGGAAGG - Intergenic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1152859082 17:82685211-82685233 AGGAATGGGGAGGGGGAGGGAGG + Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1152950462 17:83227261-83227283 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1153053113 18:919021-919043 AGTAATGGGGAGGAAAAGGAAGG - Intergenic
1153202239 18:2657626-2657648 TGGAGTGGGAAGGAGGAGGAAGG - Intronic
1153515428 18:5896289-5896311 CGCACCGGGGAGGAGCAGGAGGG - Intergenic
1154031274 18:10756192-10756214 GGCAAAGGGGATAAGGAGGAGGG + Intronic
1154031321 18:10756460-10756482 AGCTATGAGGATGAGGAGGAGGG + Intronic
1154031359 18:10756657-10756679 AGCTATGAGGATGAGGAGGAGGG + Intronic
1154031549 18:10757558-10757580 AGCTATGGGGATGAGGATGAGGG + Intronic
1154980676 18:21500088-21500110 GGCAGCAGGGAGGAGGAGGATGG - Exonic
1155130830 18:22933282-22933304 CGCGATGGGCAGCTGGAGGAAGG + Intronic
1155326798 18:24672662-24672684 AGGAATGGGGAAGTGGAGGAGGG - Intergenic
1155442965 18:25881186-25881208 GGCAGTGGGGATGAGGAGGAGGG + Intergenic
1156202862 18:34854137-34854159 GACAATGGGGAGTAGGAGAATGG + Intronic
1156442836 18:37208825-37208847 AGCAATGGGAGTGAGGAGGAAGG + Intronic
1157470266 18:47983131-47983153 AGGAAAGGGGAGGAGGGGGAAGG - Intergenic
1157472053 18:47997143-47997165 AGAAAGGAGGAGGAGGAGGAGGG - Intergenic
1157481847 18:48060234-48060256 AGCAGAGGGGAGAAGGAGGAGGG + Intronic
1157482732 18:48065959-48065981 CTTATTGGGAAGGAGGAGGAGGG - Intronic
1157491735 18:48128222-48128244 CTAAATGGAGAGGAGGATGAAGG - Intronic
1157699425 18:49751579-49751601 AGCAGTGGGGAGGAGGTTGATGG - Intergenic
1157914858 18:51654950-51654972 CACAATGGGGAGGCGGAGTGGGG - Intergenic
1158423170 18:57313669-57313691 GGCAGGGAGGAGGAGGAGGAGGG + Intergenic
1158610491 18:58935443-58935465 GGAAATGGGGAGGAGGGAGAAGG - Intronic
1158757596 18:60345306-60345328 TGCCAAGAGGAGGAGGAGGAGGG + Intergenic
1159207649 18:65274198-65274220 GGCAATGGGGAGAAGGATGTAGG + Intergenic
1159424088 18:68261328-68261350 GGGAATGGGCAGGAGGAGAAAGG + Intergenic
1159620851 18:70636753-70636775 CACACTGGGGAGGCTGAGGAGGG - Intronic
1160367023 18:78335346-78335368 GGCTACAGGGAGGAGGAGGAGGG + Intergenic
1160367057 18:78335441-78335463 GGCCAGAGGGAGGAGGAGGAGGG + Intergenic
1160392680 18:78546971-78546993 AGGAAGGGGGAGGAGGAGGGAGG + Intergenic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1160819752 19:1052460-1052482 GGCGAAGGGGAGGAGTAGGAGGG + Intronic
1160872059 19:1282164-1282186 AGGGAAGGGGAGGAGGAGGAAGG + Intergenic
1160935467 19:1592613-1592635 CGCAATGGAGCGGAAGAGGTGGG - Exonic
1161059770 19:2209125-2209147 GACAGTGGGGAGGAGCAGGAAGG - Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161415644 19:4145196-4145218 GGCAAGAGGGAGGAGGAGGAAGG + Intergenic
1161802432 19:6423920-6423942 CGAAATGGGGAAGACGAGCATGG - Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1162024161 19:7884405-7884427 GGAAAGAGGGAGGAGGAGGAGGG + Intergenic
1162080464 19:8214888-8214910 GGCAGTGGGGAGGAGGTGGGAGG + Intronic
1162475370 19:10896428-10896450 GGCAATGGGGATGGGGAAGAGGG - Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1162867900 19:13562667-13562689 CTCAGTGGGGAGGACAAGGAAGG + Intronic
1163286606 19:16352343-16352365 CCCGAGGAGGAGGAGGAGGAAGG - Intergenic
1163435540 19:17292973-17292995 CTCAAGGGGGAGCTGGAGGATGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164592072 19:29512663-29512685 AGGAAGGGGGATGAGGAGGAAGG + Intergenic
1164592636 19:29514596-29514618 GGAAAGGGGGATGAGGAGGAAGG + Intergenic
1164694218 19:30231534-30231556 GCCAATGGGGAGGAGTGGGAGGG + Intronic
1164881653 19:31738026-31738048 CTCTATGGGGATGAGAAGGAAGG + Intergenic
1165015870 19:32879614-32879636 GGGAATGGGGAGCAGCAGGACGG + Intronic
1165351565 19:35278693-35278715 CGCAGTGGAGCGGAGGCGGAGGG + Exonic
1165403612 19:35617266-35617288 CGCTAGGGAGAAGAGGAGGAAGG - Exonic
1165428195 19:35757005-35757027 TGCAACGCGGAGGAGCAGGATGG - Exonic
1165478435 19:36046429-36046451 ACCAGTGGGGAGGAGGTGGATGG + Intronic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166294737 19:41883337-41883359 GGAAGTGGGGAGGAGGAGGGAGG + Intronic
1166764456 19:45244649-45244671 GGCAGTGAGGAAGAGGAGGAGGG - Intronic
1166823902 19:45597739-45597761 GGGCATGGGGAGGAGGGGGAAGG + Intronic
1166975331 19:46602069-46602091 AGCACTGCAGAGGAGGAGGAGGG + Intronic
1166979094 19:46622207-46622229 CCCATTGGGGAGGGGCAGGACGG + Intronic
1167250293 19:48395656-48395678 CCAAGCGGGGAGGAGGAGGAGGG - Intronic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167695713 19:51014706-51014728 CCGACTGGGGAGGAAGAGGATGG + Exonic
1168357727 19:55712878-55712900 AGGAGGGGGGAGGAGGAGGAGGG + Intronic
925454413 2:4003014-4003036 CGGAGTGGTGTGGAGGAGGATGG - Intergenic
926754901 2:16226828-16226850 CACCAGGGGAAGGAGGAGGAGGG - Intergenic
927135020 2:20090757-20090779 CGAAGTGTGGAGGAGGAGGAGGG - Intergenic
927181582 2:20450389-20450411 GGGAATGGGGAGGAGGGGGAAGG - Intergenic
927439613 2:23103873-23103895 TGCAATGGGGATGTGAAGGAGGG - Intergenic
927935268 2:27072388-27072410 AGGAATGGAGAAGAGGAGGAAGG + Intergenic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
929859070 2:45660253-45660275 AGAAGTGAGGAGGAGGAGGAAGG + Intronic
930409306 2:51003745-51003767 AGCAAAGGAGAGGGGGAGGAAGG + Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930695014 2:54402512-54402534 CCCAAAGGAGAGGAGGAAGAAGG + Intergenic
930990712 2:57650685-57650707 GGCAATGGGGAGTCTGAGGATGG + Intergenic
931166656 2:59756190-59756212 GGCAATGGGGAGGAGGTGTTTGG - Intergenic
931442391 2:62299444-62299466 TGCCAGGAGGAGGAGGAGGAGGG + Intergenic
931805303 2:65798085-65798107 AGGAAAGGGGTGGAGGAGGAGGG + Intergenic
931891756 2:66680953-66680975 AGCAGTTGGGAGGATGAGGAAGG + Intergenic
932024498 2:68119793-68119815 CTGAAAGGGGAGGAGGGGGAAGG - Intergenic
932485120 2:72080005-72080027 AGCAAGGGGGGGGAAGAGGAGGG + Intergenic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
933698851 2:85239832-85239854 CCCACTGGGGAGGATGAGGCAGG + Intronic
933998402 2:87686583-87686605 CCCAACTGGGAGGAGGCGGATGG - Intergenic
934655569 2:96115374-96115396 TCCACTGGGGAGAAGGAGGAGGG - Exonic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
936295447 2:111264290-111264312 CCCAACTGGGAGGAGGCGGATGG + Intergenic
936379421 2:111970786-111970808 AGGAGGGGGGAGGAGGAGGAGGG - Intronic
936505339 2:113101246-113101268 CGCAGTGGGGGTGAGGAGTAGGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937321068 2:120961097-120961119 CTCAATGTGGTGGAGGGGGAGGG - Intronic
938323210 2:130379555-130379577 GGCATTGGGGAGGAGAAAGAAGG - Intergenic
938639500 2:133265410-133265432 CCAAAAGGAGAGGAGGAGGAAGG + Intronic
938853924 2:135290669-135290691 CACAATGGGGTGGGGGTGGAGGG - Intronic
940690772 2:156917822-156917844 AGAAATGGGGAGGGGGATGAAGG - Intergenic
942043230 2:172084660-172084682 AGGGAGGGGGAGGAGGAGGAAGG + Intergenic
942199454 2:173556371-173556393 TGCAAACAGGAGGAGGAGGAAGG - Intergenic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942241140 2:173964773-173964795 CGCGGGGAGGAGGAGGAGGAGGG - Intronic
942248827 2:174030963-174030985 GGCAATGGGAGGGAAGAGGAGGG - Intergenic
942279273 2:174343981-174344003 CGAAATGGGGAGGCCGAGAAGGG - Intergenic
942452729 2:176118261-176118283 AGCACTGGGGGAGAGGAGGAGGG - Intronic
944762649 2:202832880-202832902 GGCAAGGGGTGGGAGGAGGAAGG + Intronic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
945656233 2:212627428-212627450 AGCAATGGTGGGGAGGAGAAGGG + Intergenic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946397246 2:219449169-219449191 CGCAGAGGGCCGGAGGAGGACGG + Exonic
947608604 2:231507553-231507575 GGCAGTGAGGAAGAGGAGGAGGG - Intergenic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947683888 2:232063149-232063171 TGCAATGGGGATGGGGAGGTGGG - Intronic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948287153 2:236794882-236794904 AACAATGGAGAGGAGGATGAGGG - Intergenic
948428310 2:237902285-237902307 AGGGATCGGGAGGAGGAGGAGGG + Intronic
948502773 2:238407106-238407128 CCCGAGGAGGAGGAGGAGGAGGG + Intergenic
948546333 2:238731757-238731779 CGGAATGGGCAGGTGGAGAATGG + Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
948831219 2:240599181-240599203 CGAGATGGTGAGGATGAGGATGG + Intronic
948916085 2:241035725-241035747 CGCCATGGGGTGGGGGATGAGGG + Intronic
948929386 2:241122392-241122414 CTCAGTGGGGAGTAGGAGAATGG + Intronic
1168828838 20:833478-833500 CGCGGGAGGGAGGAGGAGGAAGG + Intergenic
1169083062 20:2809240-2809262 GGCAGATGGGAGGAGGAGGAAGG + Intergenic
1169171777 20:3471134-3471156 GGCAAGGCTGAGGAGGAGGACGG + Exonic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170623377 20:18012157-18012179 GGCGATGGTGAGGAAGAGGATGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171202624 20:23254498-23254520 GGCAAGAGGGAGGAGGAGGGAGG + Intergenic
1171216485 20:23356277-23356299 CGCAATGGGCAGGATGGGTAGGG + Intergenic
1171266637 20:23776515-23776537 AGCAATGGGGTGGAGGGGCAGGG - Intergenic
1171276186 20:23858151-23858173 AGCAATGGGGAGGAGGGGCAGGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1171866935 20:30492898-30492920 CGCTATGGGGGGGAGGGGGGTGG + Intergenic
1172010367 20:31842896-31842918 AACAATGGGGAGGAGGAGCAAGG - Intergenic
1172100509 20:32482274-32482296 GGGAATGGGGAGGAGGGGGTGGG + Intronic
1172149552 20:32780345-32780367 CTCAATGGAGAGGAGGACGCCGG + Exonic
1172276375 20:33681881-33681903 GGCAATGGGGAGCTGGAGGAAGG - Intronic
1172764852 20:37345995-37346017 GGCAGCCGGGAGGAGGAGGAAGG - Intronic
1172980115 20:38935115-38935137 CTCAATGGGGAGGAGGGACAAGG + Intronic
1173002078 20:39111731-39111753 GGAAAAGGGGAGGAGGAGGAGGG + Intergenic
1173433290 20:43010391-43010413 CTCAATGGGGAGGATCAGCAAGG - Intronic
1173593940 20:44247141-44247163 GGCCAGGGGGAGGAGGAGAAAGG + Intronic
1173664448 20:44754612-44754634 AGGAAGGGGGCGGAGGAGGAGGG + Intronic
1173811489 20:45958580-45958602 AGCAAGAGGGAAGAGGAGGATGG - Intronic
1174150379 20:48482168-48482190 AGCAGGGGGAAGGAGGAGGAGGG + Intergenic
1174582026 20:51579020-51579042 TGCTGTGGGGAGGAGGTGGAAGG - Intergenic
1175227349 20:57452347-57452369 GGTAAAGGGCAGGAGGAGGATGG + Intergenic
1175248156 20:57593571-57593593 GGCTACAGGGAGGAGGAGGAGGG + Intergenic
1176048181 20:63103275-63103297 AGCATTGGGGAGGAGGAAGTGGG + Intergenic
1176160475 20:63645158-63645180 AGGAGTGGGAAGGAGGAGGAGGG - Intronic
1176177456 20:63735412-63735434 CCCAGCGGGGAGGAGGAGCAAGG + Exonic
1176249157 20:64112080-64112102 TGCACTGTGGAGCAGGAGGAAGG + Intergenic
1176549271 21:8214454-8214476 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176557164 21:8258677-8258699 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176568203 21:8397492-8397514 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176568290 21:8397704-8397726 GGAGACGGGGAGGAGGAGGACGG - Intergenic
1176576106 21:8441712-8441734 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1176902858 21:14464522-14464544 GGCAGTGGGGAGGAAGGGGAAGG + Intergenic
1177351185 21:19944019-19944041 CGGAGTGGGGAGTAGAAGGAGGG - Intergenic
1177570045 21:22875305-22875327 AGAAATAGGGAGGAGGAGCAGGG + Intergenic
1178142239 21:29697722-29697744 AGCTATGGGGAGGAGAAGGAGGG - Intronic
1178505252 21:33157391-33157413 AGAAAGAGGGAGGAGGAGGAGGG - Intergenic
1179894234 21:44352320-44352342 GGCAAAGGGGAGGAGGGAGAGGG + Intronic
1181235603 22:21446078-21446100 TGCAAGGAGGAGGAGGAGAACGG + Exonic
1181965454 22:26653404-26653426 AGCAGTGGGGAGGTGGCGGAGGG - Intergenic
1182567695 22:31212372-31212394 GGAAATGGGGAGGAGGAGGCGGG - Intronic
1182645023 22:31801388-31801410 CACACTGGGGAGCAGGAGAAGGG - Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182897869 22:33873756-33873778 GGAAAGGAGGAGGAGGAGGAAGG - Intronic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183328144 22:37205421-37205443 GGGAAAGGGGAGGATGAGGAGGG - Exonic
1183333795 22:37235366-37235388 GGCAGTGGGGAGGAAGAGAAGGG - Intronic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1184096359 22:42318419-42318441 AGGAGAGGGGAGGAGGAGGAGGG + Intronic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184247381 22:43242506-43242528 CCCATGGGTGAGGAGGAGGAAGG - Intronic
1184412335 22:44332379-44332401 GGGAGTGGGGAGGAGGAGGAAGG - Intergenic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
1185089347 22:48757137-48757159 GGCAAGGAGGAGGAGGAGGGAGG + Intronic
1185089424 22:48757394-48757416 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1185089436 22:48757433-48757455 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1185166367 22:49265004-49265026 GGCAATGGGGAAGAGGAAGGAGG + Intergenic
1203254156 22_KI270733v1_random:130770-130792 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203262212 22_KI270733v1_random:175849-175871 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
950570472 3:13796770-13796792 GGCAAAGGGGCGGAGAAGGAGGG - Intergenic
950618090 3:14178465-14178487 CGGCGTGAGGAGGAGGAGGAGGG - Exonic
950685931 3:14618655-14618677 AGCAATGGGCAGGAAGAGGCAGG + Intergenic
951078673 3:18425716-18425738 CGCAGAGGGGAGGAGGAGAGGGG + Intronic
951109046 3:18779460-18779482 TGCAATGTGGAGGTGAAGGATGG - Intergenic
951705511 3:25540495-25540517 CTAAAAGGGGAGGAGGATGAGGG - Intronic
952107544 3:30087602-30087624 GGGGAGGGGGAGGAGGAGGAGGG - Intergenic
953374306 3:42415829-42415851 GGAAAGGAGGAGGAGGAGGAAGG + Intergenic
953906521 3:46871175-46871197 AGCACTGGGAAGGAGGAGCAGGG + Intronic
954000106 3:47549898-47549920 TGGGAGGGGGAGGAGGAGGAAGG - Intergenic
954107898 3:48419159-48419181 AGCCCTGGGGAGCAGGAGGAGGG - Intronic
954654614 3:52186340-52186362 GGCAATGCGGAGGAGCTGGAAGG - Intergenic
954774697 3:53006279-53006301 CGGAATGGGGAGGAAGAGCCTGG + Intronic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
955080489 3:55653965-55653987 AGGAATGAGGAGGAAGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955683064 3:61522566-61522588 CACACTGTGGAGGAGGGGGAAGG + Intergenic
955935321 3:64097476-64097498 CATTAAGGGGAGGAGGAGGATGG + Exonic
956529624 3:70203152-70203174 TGCTTTGGGGAGGATGAGGAGGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957979938 3:87495665-87495687 GGCAAAGTGGAGGAGGTGGAAGG + Intergenic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
958798936 3:98733816-98733838 GACAGTGGGGAGGAGCAGGAGGG + Intronic
958816641 3:98923909-98923931 GGAGAAGGGGAGGAGGAGGAAGG - Intergenic
960047388 3:113211478-113211500 TGCGAGGAGGAGGAGGAGGAGGG - Exonic
960615283 3:119590854-119590876 AGCAGTGGTGAGGGGGAGGAGGG - Intergenic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
961037600 3:123653427-123653449 ACCAAGGGGGAGGAGGAAGAGGG - Intronic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961174526 3:124822885-124822907 AGCCAGGGAGAGGAGGAGGAGGG + Intronic
961442754 3:126962548-126962570 CACTATGGGGAGGAGGGAGAGGG - Intergenic
961585046 3:127915414-127915436 CGCCCTGCGGAGGAGGAGGGAGG - Exonic
961595158 3:128010055-128010077 CTCAGTGGAGGGGAGGAGGATGG - Intergenic
962459042 3:135591768-135591790 GGGATTGGGGAGGAGAAGGAGGG - Intergenic
962545472 3:136429776-136429798 TACACTGGGGAGGAGGAAGAGGG - Intronic
962825286 3:139095468-139095490 GCCAATGGGGAGGGGAAGGAGGG - Intronic
962929333 3:140022619-140022641 GGCAATGGGGAGGGCCAGGAAGG + Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963417784 3:145020552-145020574 TGAAAGGGGGTGGAGGAGGATGG - Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963921355 3:150909029-150909051 TGCTATAGGGAGGAGGAAGAAGG + Intronic
964532230 3:157681236-157681258 TGCAATGGGGACTTGGAGGAAGG - Intergenic
964544029 3:157812897-157812919 GGGAAGGGGGAAGAGGAGGAAGG + Intergenic
964698939 3:159541597-159541619 GGCAGTGGGGAGGAAGAGGAGGG + Intronic
965165993 3:165195022-165195044 AGCAGTGGGGAGGAGGAAGTGGG - Intronic
966559211 3:181300141-181300163 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
967087488 3:186108525-186108547 CGCAGTTGGGAGGAGGGGGCGGG - Intronic
967630175 3:191736522-191736544 AGTAATGGGGAAGGGGAGGATGG - Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968557653 4:1255689-1255711 TGCACTGGGGAGAAGGAGGAGGG - Intergenic
968889297 4:3359193-3359215 GGAGAAGGGGAGGAGGAGGAGGG - Intronic
968938470 4:3625685-3625707 GGCCCTGGGGAGGAGGAGGTTGG - Intergenic
969048839 4:4358237-4358259 AGCAATGGGGAAGAAGAGCAAGG + Intronic
969129661 4:4982226-4982248 CCCATAGGGGAGGAGGTGGAGGG - Intergenic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969606415 4:8204414-8204436 AGCAATGGGGATGCAGAGGAAGG - Intronic
969670163 4:8585792-8585814 CGGGATGGGGATGAGGAGGCTGG - Intronic
971633800 4:29031241-29031263 GGGAAGGGGGAGGGGGAGGAGGG - Intergenic
971784647 4:31084760-31084782 GGAGATGGGGAGGAGGGGGAGGG + Intronic
972169176 4:36324128-36324150 AGGAATGGGGGGGAGGAGAAGGG - Intronic
972668493 4:41191171-41191193 TGGAGTGGGGAGGATGAGGAGGG + Intronic
975372863 4:73608066-73608088 AGCAAGGAGGAGGAGGAAGAGGG - Intronic
975687233 4:76929180-76929202 AGGAAGGGAGAGGAGGAGGAAGG + Intergenic
976096414 4:81513072-81513094 GGAAAGGGGGAGGGGGAGGAGGG - Intronic
976246483 4:83010832-83010854 CGGGGAGGGGAGGAGGAGGAAGG - Intronic
976439682 4:85058863-85058885 TGAAATGGGGAGGAGAGGGAGGG + Intergenic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977557756 4:98502129-98502151 CGCAATTGGGAAGAGCAGGTTGG + Intronic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978532529 4:109729759-109729781 GGCCATGAGGAGGAGCAGGAGGG + Exonic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
979565702 4:122152363-122152385 CCCAAGGGGGCGGAGGAGGAGGG - Exonic
980834985 4:138180273-138180295 AGCCATGGTGAGGAGGAGTAAGG - Intronic
981364113 4:143881839-143881861 TGCAATGGAGTGGAGGTGGAAGG + Intronic
981385169 4:144121921-144121943 TGCAATGGAGTGGAGGTGGAAGG + Intronic
981675397 4:147337935-147337957 AGCAATTTGGAAGAGGAGGATGG + Intergenic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982257736 4:153466622-153466644 GGAAAGGGGCAGGAGGAGGAAGG + Intronic
982668175 4:158291598-158291620 CTCAGTGGGGAGGAGCAGGCAGG - Intergenic
983144519 4:164197131-164197153 GGCGAGGAGGAGGAGGAGGAAGG - Intronic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
983919821 4:173333856-173333878 CGGGAGGAGGAGGAGGAGGAGGG - Intronic
984087207 4:175327535-175327557 TGCAAAGGAGAGAAGGAGGAAGG - Intergenic
985011638 4:185588606-185588628 AACAAGGAGGAGGAGGAGGAGGG - Intronic
985282214 4:188298702-188298724 GGCACTGGAGAGGAGGAGGTGGG + Intergenic
985490722 5:176973-176995 CGCAATGGGGAGGGGGTGCCAGG - Intronic
985901694 5:2800822-2800844 AGCAATTGGGATGTGGAGGAAGG - Intergenic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
987174053 5:15289091-15289113 GGAAATGGGGTGGGGGAGGAGGG - Intergenic
987325959 5:16811961-16811983 CGCTAAGGAGAGGAGGAGCAGGG - Intronic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
990102807 5:52213909-52213931 CACAATGTGGAGGTGGAAGATGG + Intergenic
990713400 5:58609040-58609062 GGGAGTGGGGAGGAGGGGGAGGG + Intronic
991074458 5:62519329-62519351 GGAAATGAGGAGGAGGAGCAGGG - Intronic
991464019 5:66891331-66891353 GGCAGTGAGGAGGAGGAGGAGGG - Intronic
991930600 5:71749815-71749837 CTCTATGGGGAGGATGTGGAGGG + Intergenic
992197249 5:74352095-74352117 ACCAGTGGGGATGAGGAGGATGG + Intergenic
992349704 5:75916369-75916391 GGGGAAGGGGAGGAGGAGGAAGG - Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992874748 5:81042928-81042950 CGCTGTGAGGAGGAGCAGGATGG + Exonic
992987537 5:82248449-82248471 GACATTGGGGAAGAGGAGGAGGG + Intronic
993852077 5:93023180-93023202 CCCAATGGAGAGCAGCAGGAAGG - Intergenic
994721849 5:103389593-103389615 GGCAGTGGGGAGGAAGAGGCAGG + Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
998681018 5:144467574-144467596 AGCAACGGGCAGGAGGAGGTTGG + Intronic
998712070 5:144837519-144837541 AGAAATGGTGAGGATGAGGATGG + Intergenic
998969195 5:147572912-147572934 AGCCATGGGGAGGAAGTGGAAGG - Intergenic
999040248 5:148401609-148401631 CCCATGGGGGAGGAGGAGGGTGG + Intronic
999442108 5:151610075-151610097 TGCACTGCTGAGGAGGAGGAAGG + Intergenic
999676127 5:154004726-154004748 GGTAATAGGGAGGAGGAAGACGG - Intronic
1001132917 5:169079578-169079600 AGAGAAGGGGAGGAGGAGGAGGG + Intronic
1001270120 5:170304744-170304766 CTCAAGGGGGAAGAGGAGGTAGG + Intergenic
1001425267 5:171618509-171618531 AGGAAAGGGGAGGAGGAGGGAGG - Intergenic
1001600152 5:172923297-172923319 AGCATCTGGGAGGAGGAGGAGGG + Intronic
1002294891 5:178224726-178224748 CGCACTGGGGAGGAGAAGGGAGG + Exonic
1002449758 5:179311973-179311995 AGCAGTGGGGAGGAGGGAGAAGG + Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002715486 5:181224180-181224202 CGGGAGGAGGAGGAGGAGGACGG + Exonic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1002744694 5:181461076-181461098 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1002837909 6:880825-880847 GGCAGTGGGCAGGAGCAGGAGGG - Intergenic
1002844888 6:937364-937386 GACAAGGAGGAGGAGGAGGATGG - Intergenic
1002930561 6:1631664-1631686 TGGATTGGGGAGAAGGAGGAAGG - Intronic
1003466347 6:6383544-6383566 TGCATTCAGGAGGAGGAGGAAGG - Intergenic
1003679985 6:8243398-8243420 AGAAATGGGAAAGAGGAGGAGGG - Intergenic
1004413225 6:15400762-15400784 AGCAATGGGGCCGAGGGGGAGGG - Intronic
1004565473 6:16791998-16792020 CCCAATGGGGAGAGGGAGGGAGG - Intergenic
1004576765 6:16903591-16903613 GGCAGTGGGCAGGAAGAGGAAGG + Intergenic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1004924077 6:20402474-20402496 GGCACTGGGGAGGAGGGGGCCGG - Exonic
1005602731 6:27444238-27444260 TGCAATGGGTTGGTGGAGGATGG - Intergenic
1005989694 6:30895383-30895405 CGCTGTCGGGAGAAGGAGGAGGG - Exonic
1006119409 6:31795129-31795151 CGCTATGGGGAGGCTGGGGAGGG - Exonic
1006132360 6:31877297-31877319 TGCCATGGGGAGGGGAAGGAAGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1006756410 6:36419462-36419484 GGCAAAGGGGCAGAGGAGGAAGG + Intronic
1006904659 6:37525206-37525228 TGCAATCTGGTGGAGGAGGAGGG + Intergenic
1006954157 6:37852197-37852219 CTCCATGGGGGTGAGGAGGATGG + Intronic
1007371717 6:41430495-41430517 GGGAATGGGGAGTGGGAGGAAGG + Intergenic
1007390066 6:41545862-41545884 CGCAGTGGGGAGCAGGAGGGAGG + Intergenic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1009808811 6:68635435-68635457 TGCAGGGGGGAGGAGGAGGAGGG + Exonic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1012899286 6:104988681-104988703 CGCAAAGCGGAGGCGGAGGCAGG - Intronic
1013314396 6:108927194-108927216 GGAAATGGGGAAGTGGAGGAAGG + Intronic
1013836795 6:114343154-114343176 AGCGAAAGGGAGGAGGAGGAGGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014397844 6:120948504-120948526 CTCAAGGTGGAGTAGGAGGAGGG - Intergenic
1014861979 6:126480083-126480105 GGCAAGGGGAAGTAGGAGGATGG - Intergenic
1015190000 6:130461883-130461905 CACAATTGTGGGGAGGAGGAGGG - Intergenic
1015389929 6:132670127-132670149 GGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1015536319 6:134270872-134270894 CTCAATGGGGAGGATGAGGAGGG - Intronic
1015601486 6:134915301-134915323 TGCAATGCTGGGGAGGAGGAAGG - Intergenic
1015832940 6:137389219-137389241 TGCAATAGGGATTAGGAGGAAGG + Intergenic
1017540235 6:155394229-155394251 GGGAGTGGGGAGGGGGAGGAAGG - Intergenic
1017810727 6:157981791-157981813 GCGAGTGGGGAGGAGGAGGAAGG + Intergenic
1018839566 6:167508198-167508220 GGGGATGGGGAGGAGGGGGATGG - Intergenic
1018960986 6:168448411-168448433 GGCAATGGGGAGGACGATGATGG + Intronic
1019223813 6:170494998-170495020 AGCAGTGGTGAAGAGGAGGATGG + Intergenic
1019223838 6:170495117-170495139 AGCAGTGGTGAAGAGGAGGATGG + Intergenic
1019223872 6:170495276-170495298 AGCAGTGGTGAAGAGGAGGATGG + Intergenic
1019223906 6:170495435-170495457 AGCAGTGGTGAAGAGGAGGATGG + Intergenic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019249605 6:170734617-170734639 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1019419303 7:943249-943271 AGGAAGGGAGAGGAGGAGGAAGG + Intronic
1019501173 7:1365405-1365427 AGCAAAGGGGTAGAGGAGGATGG + Intergenic
1019502259 7:1370131-1370153 GGCAGTGGGGAGGTGGAGGCCGG + Intergenic
1019516975 7:1444482-1444504 GGGAATGGGGAGGAGGAGCCAGG - Intronic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019776108 7:2912983-2913005 GGTGATGGGGAGGAGGAGGAGGG + Intronic
1020017906 7:4842203-4842225 GGCAATGGGGAAGATGGGGATGG + Intronic
1020080180 7:5282684-5282706 AGGAATGGGGAGGAGGAAGAAGG + Intronic
1020080205 7:5282756-5282778 AGGAATGGGGAGGAGGGGGAGGG + Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1020823033 7:12994253-12994275 CATAATGGGGAGGAGAAAGAAGG - Intergenic
1021616488 7:22507529-22507551 GGCAATGGGGAGGAGCATGCTGG - Intronic
1022122545 7:27323501-27323523 GGCCATGGGGAACAGGAGGAAGG - Intergenic
1022427650 7:30284511-30284533 CGGAAGGGGGAGGCGGAGCAAGG + Exonic
1022926289 7:35058738-35058760 GGCAATGGGGAGGAGCATGCTGG - Intergenic
1023654473 7:42406045-42406067 GGCAATGGGGAGCTGGAGGATGG + Intergenic
1023850220 7:44146158-44146180 CGAGACGGGGAGGAGGGGGAGGG - Intronic
1024109795 7:46133651-46133673 GTCAAAGAGGAGGAGGAGGAGGG - Intergenic
1024112042 7:46157180-46157202 GGCAGTGGGGAGGAGTGGGAAGG + Intergenic
1024373900 7:48617283-48617305 AGGGATGGAGAGGAGGAGGAAGG - Intronic
1024568216 7:50702040-50702062 CTCAGTGGGGAGGGGGAGGCAGG - Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025198800 7:56949724-56949746 AGAAATGGGGAGGAGTGGGAGGG - Intergenic
1025673146 7:63627209-63627231 AGAAATGGGGAGGAGTGGGAGGG + Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026238016 7:68545739-68545761 GGGGAGGGGGAGGAGGAGGAGGG - Intergenic
1026459337 7:70599671-70599693 ACCTATGGGAAGGAGGAGGAAGG + Intronic
1027848243 7:83413539-83413561 TGCACTTGGGAGGATGAGGATGG + Intronic
1028375969 7:90146808-90146830 GGCAATGGGGAGGAGCATGCTGG + Intergenic
1028908281 7:96178776-96178798 GACAAATGGGAGGAGGAGGAGGG - Intronic
1029125279 7:98291158-98291180 CCCAAAGGGGAAGAGGATGATGG - Exonic
1029975389 7:104828573-104828595 TTCATTGGGGTGGAGGAGGAAGG + Intronic
1029987302 7:104934154-104934176 TGAACTGGGGAGGAGGAGGGAGG - Intergenic
1030058938 7:105607773-105607795 GGCCATGGGGAGGAGGAGGGAGG - Exonic
1030560820 7:111083509-111083531 CGCAAAGGAGAGGAGAACGAGGG + Intronic
1031873012 7:127108105-127108127 GGCAAAGGGCAGGAGGAGGTGGG - Intronic
1031952283 7:127904685-127904707 CACAATGGGAAGGGGTAGGAGGG - Intronic
1033019664 7:137711022-137711044 GAAAAGGGGGAGGAGGAGGACGG - Intronic
1033334850 7:140443905-140443927 CTAAATAGGGAGGAGGAGGTGGG + Intergenic
1033436063 7:141334669-141334691 TGCAAAGAGGAGGAGGATGAGGG - Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034460922 7:151197659-151197681 CGGCATGGGGAAGAGGAGCAAGG - Intronic
1034470678 7:151252757-151252779 AGCCAGGAGGAGGAGGAGGAAGG - Intronic
1034559557 7:151871450-151871472 TGCAATGGAGAGGAAGGGGAAGG - Intronic
1034636645 7:152572569-152572591 CGTAATGGGGAGGAGGAAAGCGG - Intergenic
1034889430 7:154827303-154827325 GGAAAAGGGGAGGAGGAAGAGGG - Intronic
1034945447 7:155259051-155259073 GGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1034994884 7:155571172-155571194 CGGGAAGGGGTGGAGGAGGAGGG - Intergenic
1035185158 7:157120625-157120647 GGCAAGGGAGAGGAAGAGGAAGG + Intergenic
1035265294 7:157686761-157686783 AGAAGTGAGGAGGAGGAGGAGGG + Intronic
1035498491 8:73039-73061 AGGAGTGGGGAGGAGGAGGAGGG - Intronic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035732062 8:1860325-1860347 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732084 8:1860392-1860414 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732102 8:1860456-1860478 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036451165 8:8869053-8869075 TGCAGAGAGGAGGAGGAGGAAGG + Intronic
1037700690 8:21271641-21271663 GGGAAAGGGGAGGAGGAGGTGGG - Intergenic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1037760433 8:21738209-21738231 GGAAGAGGGGAGGAGGAGGAGGG - Intronic
1037803113 8:22045649-22045671 GCCAGTGGGGAGGATGAGGAAGG + Intronic
1037931314 8:22881994-22882016 CTCAATGGGGCAGATGAGGAAGG + Intronic
1038232413 8:25714789-25714811 AGGAAAGGGAAGGAGGAGGAAGG - Intergenic
1038315873 8:26483910-26483932 AGCAGGAGGGAGGAGGAGGATGG + Intronic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038780350 8:30564612-30564634 CACAATGGGCAGGAGCAGGTTGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039443546 8:37612345-37612367 GCCCATGGGGAGAAGGAGGAAGG + Intergenic
1039548679 8:38428255-38428277 CTGAAAGGGGAGGAAGAGGAGGG - Intronic
1039792954 8:40890482-40890504 GGCAATGGGGAGGGGGAGGAGGG - Intronic
1040079789 8:43274967-43274989 GGGAAGGGGGAGGAGGAAGAGGG - Intergenic
1040079828 8:43275084-43275106 GGAAAAGTGGAGGAGGAGGAGGG - Intergenic
1041063774 8:54061489-54061511 GGCAATGGAGATGAGGTGGATGG - Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1042130438 8:65582512-65582534 GGTGAGGGGGAGGAGGAGGAAGG + Intergenic
1042517438 8:69674295-69674317 AGCAATGGGAGGGAGGAGGGAGG + Intronic
1043295303 8:78654467-78654489 GGCAGAGGGGAGGGGGAGGAAGG - Intergenic
1044798121 8:95924759-95924781 CTCCATGGGGAGGAGGAGAAGGG - Intergenic
1045423885 8:102043718-102043740 AGGGAGGGGGAGGAGGAGGATGG + Intronic
1045459396 8:102412750-102412772 GGCAAACGGGAGGAGGAGGAGGG + Exonic
1046338226 8:112818757-112818779 CTCAAAGGGGAGGTGGAGAAGGG - Intronic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1047671706 8:127155073-127155095 CGGAATGGTGAGAAGGAAGATGG + Intergenic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048188630 8:132267291-132267313 GGCAATGGGAATCAGGAGGAAGG - Intronic
1048766127 8:137846353-137846375 GGAAAGGGGGAGGAGGAAGAGGG - Intergenic
1048861023 8:138724564-138724586 AGCAATGGGGAGAGGGAGGAGGG + Intronic
1049404380 8:142445203-142445225 CGCATGGGGGCGCAGGAGGAAGG - Intergenic
1049405524 8:142450336-142450358 CGCATTGGGCAGGCTGAGGAGGG + Intronic
1049593343 8:143472483-143472505 AGCAGTGGGGAGGAGAGGGAGGG - Intronic
1049632349 8:143665553-143665575 GGGAATGGGGATGAGGGGGATGG + Intergenic
1049746607 8:144265769-144265791 CTCCATGGGGAGGAGAGGGAAGG - Intronic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1050328696 9:4523071-4523093 AGGGATGGGGAGGAGGAGGCTGG - Intronic
1050350156 9:4733745-4733767 GCCAATGGGGAGGATGAGGGAGG - Intronic
1050475906 9:6040909-6040931 AGTAAGGAGGAGGAGGAGGAAGG - Intergenic
1051261957 9:15273453-15273475 AGGAATGTGGAGGAGGAGGGAGG - Intronic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051426193 9:16934094-16934116 AGCAATGAGGAGGAGCATGAAGG + Intergenic
1052208550 9:25872627-25872649 GGCAGTGGGGATGGGGAGGAAGG - Intergenic
1052305680 9:27006663-27006685 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1053582789 9:39424609-39424631 AGCAATGTGAAGGGGGAGGAAGG - Intergenic
1054104368 9:60983352-60983374 AGCAATGTGAAGGGGGAGGAAGG - Intergenic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054581976 9:66923498-66923520 AGCAATGTGAAGGGGGAGGAAGG + Intronic
1055116825 9:72613839-72613861 ACCAATGGCGAGAAGGAGGAAGG + Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055955919 9:81773440-81773462 TGCACCCGGGAGGAGGAGGATGG - Intergenic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1057181519 9:93033280-93033302 GGGGACGGGGAGGAGGAGGAGGG - Intronic
1057226901 9:93297204-93297226 TGCAAAGGGGAGGATGCGGAGGG - Intronic
1057860990 9:98640685-98640707 CCCCCTGGAGAGGAGGAGGAGGG + Intronic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058622186 9:106895368-106895390 CGCACTGGGGATGAAGAGGAGGG - Intronic
1058734022 9:107877633-107877655 CACAATGGGGACTAGAAGGAAGG + Intergenic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059651888 9:116322862-116322884 AGGAATGGGGAGGAGGAGTGCGG - Intronic
1059733068 9:117075497-117075519 GGGGAGGGGGAGGAGGAGGAGGG + Intronic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060190287 9:121588416-121588438 CCCAGTTGGGATGAGGAGGACGG - Intronic
1060553853 9:124498546-124498568 TGCAGAGGGGAGGAGGAGCAGGG - Intronic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1061248481 9:129413575-129413597 GGCACCGGGGAGGAGGGGGAAGG + Intergenic
1061252133 9:129432655-129432677 AGCGATGGGGAGGAGGAAGCTGG - Intergenic
1061271399 9:129545573-129545595 GGCATTGGGGTGGAGGATGAAGG - Intergenic
1061498915 9:130991250-130991272 CCCAATGGGGGTGAGCAGGAGGG + Intergenic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061989194 9:134149013-134149035 GTCACTGGGGAGGAGGAGGACGG + Intronic
1062226641 9:135456174-135456196 CGACGTGGGGAGGAGGAGAAGGG - Intergenic
1062370460 9:136236172-136236194 GGGAGTGGGGAGGAGGTGGAGGG - Intronic
1062411851 9:136429801-136429823 CGGAATGCTGTGGAGGAGGAGGG + Exonic
1062676969 9:137752367-137752389 GACACCGGGGAGGAGGAGGAAGG + Exonic
1203470557 Un_GL000220v1:113914-113936 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203478378 Un_GL000220v1:157886-157908 CCCTCCGGGGAGGAGGAGGAGGG - Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1203610505 Un_KI270748v1:91555-91577 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1185495701 X:553323-553345 TGAAATGGGGAGGTGGAGGGGGG + Intergenic
1185550527 X:980196-980218 TGCAAGGGGGAGGAGGAGGGAGG + Intergenic
1185608477 X:1380532-1380554 GGGGAAGGGGAGGAGGAGGAGGG + Intronic
1185688241 X:1948188-1948210 AGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1185688530 X:2133727-2133749 AGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1186882272 X:13878338-13878360 CCCAATGGGAAGGTGGGGGAAGG + Intronic
1187867906 X:23740764-23740786 CGCACTGAGGTGGAGGAGGTGGG + Intronic
1189137345 X:38562552-38562574 GGGAGGGGGGAGGAGGAGGAGGG + Intronic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189236731 X:39492742-39492764 GGCAAGGGGACGGAGGAGGAAGG - Intergenic
1189446676 X:41086369-41086391 GGGAAGGGGGAGGAGGGGGAGGG - Intronic
1190329396 X:49226436-49226458 GGCGATGAGGATGAGGAGGAGGG - Exonic
1191252992 X:58268225-58268247 CGCAAGGCAGAGGAGGAGGCTGG - Intergenic
1191580832 X:62758996-62759018 CACACTGGTGAGGAGGAGGAAGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192180272 X:68911971-68911993 AGGTCTGGGGAGGAGGAGGATGG - Intergenic
1192452384 X:71252490-71252512 AGTAGTGGGGAGGAGGAGGGTGG - Intronic
1192478657 X:71466082-71466104 TGGGATGGGGAGGAGGGGGATGG + Intronic
1192629952 X:72769617-72769639 CACAATGAGGAGGATGGGGAAGG - Intergenic
1192651758 X:72951187-72951209 CACAATGAGGAGGATGGGGAAGG + Intergenic
1193036399 X:76956142-76956164 CGCCATGGTGTGGAGGAGGGTGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193283276 X:79682048-79682070 GGCAGTGAGGAGGAGGAGTAAGG - Intergenic
1195027712 X:100894630-100894652 GGCAGTGGGGAGGAGTGGGATGG + Intergenic
1196808524 X:119609872-119609894 TGCAATAGAGAGGAGGAGGATGG - Intergenic
1197770644 X:130087033-130087055 CCCATAGGGGAGGAAGAGGAGGG + Intronic
1198150579 X:133904495-133904517 TGAAATGGAGAGGAGGAGGTAGG + Intronic
1198721269 X:139623572-139623594 CAAAAGGGGGAAGAGGAGGAAGG + Intronic
1198936543 X:141906119-141906141 AGTAAAGTGGAGGAGGAGGAGGG - Exonic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic
1201122397 Y:10883172-10883194 TGCAATGGAGTGGAGGAGAATGG - Intergenic
1201124505 Y:10900958-10900980 TGGAATGGGGAGGAGAAGAATGG - Intergenic
1201144131 Y:11053517-11053539 AGAGATGGGGAGGAGTAGGAGGG - Intergenic
1201731086 Y:17203960-17203982 AGGGATGGGGAGGAGGAGAAAGG + Intergenic