ID: 1038611118

View in Genome Browser
Species Human (GRCh38)
Location 8:29060947-29060969
Sequence GACTCTCACGAGTTTACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038611118_1038611120 2 Left 1038611118 8:29060947-29060969 CCCAGCGTAAACTCGTGAGAGTC No data
Right 1038611120 8:29060972-29060994 TTTTCCACGTCATCATTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038611118 Original CRISPR GACTCTCACGAGTTTACGCT GGG (reversed) Intronic