ID: 1038612249

View in Genome Browser
Species Human (GRCh38)
Location 8:29068123-29068145
Sequence ATGGCACCCAAGGCCGGGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612249_1038612257 0 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612257 8:29068146-29068168 CTGCGGGCCGACCCACACTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1038612249_1038612261 12 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612249_1038612262 13 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612249_1038612263 14 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612249_1038612264 23 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612249 Original CRISPR ATGGCACCCAAGGCCGGGAA GGG (reversed) Exonic