ID: 1038612250

View in Genome Browser
Species Human (GRCh38)
Location 8:29068124-29068146
Sequence GATGGCACCCAAGGCCGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612250_1038612261 11 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612250_1038612263 13 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612250_1038612262 12 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612250_1038612257 -1 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612257 8:29068146-29068168 CTGCGGGCCGACCCACACTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1038612250_1038612264 22 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612250 Original CRISPR GATGGCACCCAAGGCCGGGA AGG (reversed) Exonic