ID: 1038612252

View in Genome Browser
Species Human (GRCh38)
Location 8:29068129-29068151
Sequence CCGCAGATGGCACCCAAGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612252_1038612267 27 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612252_1038612263 8 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612252_1038612261 6 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612252_1038612262 7 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612252_1038612268 28 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612252_1038612264 17 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612252_1038612257 -6 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612257 8:29068146-29068168 CTGCGGGCCGACCCACACTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612252 Original CRISPR CCGCAGATGGCACCCAAGGC CGG (reversed) Exonic