ID: 1038612255

View in Genome Browser
Species Human (GRCh38)
Location 8:29068133-29068155
Sequence CGGCCCGCAGATGGCACCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612255_1038612268 24 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612255_1038612261 2 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612255_1038612263 4 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612255_1038612262 3 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612255_1038612264 13 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612255_1038612267 23 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612255_1038612257 -10 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612257 8:29068146-29068168 CTGCGGGCCGACCCACACTAAGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612255 Original CRISPR CGGCCCGCAGATGGCACCCA AGG (reversed) Exonic