ID: 1038612256

View in Genome Browser
Species Human (GRCh38)
Location 8:29068142-29068164
Sequence AGTGTGGGTCGGCCCGCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612256_1038612264 4 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612256_1038612263 -5 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612256_1038612268 15 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612256_1038612273 29 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612273 8:29068194-29068216 CGCATCGGGAGTCCTAAGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1038612256_1038612261 -7 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612256_1038612262 -6 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612256_1038612271 25 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612271 8:29068190-29068212 GGAGCGCATCGGGAGTCCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 25
1038612256_1038612272 28 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612256_1038612267 14 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612256 Original CRISPR AGTGTGGGTCGGCCCGCAGA TGG (reversed) Exonic
900505613 1:3028666-3028688 AGAGTGGGGCGGCCCACAGCAGG + Intergenic
901875517 1:12165104-12165126 AGCCTGGGTCGGCCTGGAGAAGG + Intergenic
904290334 1:29481229-29481251 CATGTGGGTGGGCACGCAGATGG + Intergenic
904354909 1:29932752-29932774 AGTGTGGATGGGTCAGCAGAAGG + Intergenic
905207970 1:36353710-36353732 AGAGTGGGATGGCCTGCAGATGG - Intronic
905485980 1:38296928-38296950 AGGGTGGGTGGGCCTGGAGAGGG - Intergenic
1062919145 10:1266171-1266193 CGTGTGGGTCGGCGCCGAGAAGG + Intronic
1065623250 10:27605491-27605513 AGTGTGGGTGGCCCCAGAGAGGG - Intergenic
1065748176 10:28860903-28860925 GGTGTGGGTTGGCCCGTGGATGG - Intronic
1082627440 11:55502092-55502114 AATGTGGGTTGGCCCTCTGAAGG + Intergenic
1083270598 11:61570292-61570314 AGTGTGGGGTGGCAGGCAGAAGG + Intronic
1084246429 11:67860679-67860701 ACTGTGGGCAGCCCCGCAGATGG + Intergenic
1084826252 11:71733822-71733844 ACTGTGGGCAGCCCCGCAGATGG - Intergenic
1091656242 12:2348696-2348718 AGTGTGGGGCGCCCTGGAGAAGG + Intronic
1096466424 12:51849314-51849336 GGTCTGGGGCGGCCCGCGGACGG - Intergenic
1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG + Intergenic
1122865866 14:104603725-104603747 GGAGTGGGTGGGCCCCCAGAGGG + Intronic
1124092996 15:26623833-26623855 AGGGTGGGTCAGGCAGCAGAGGG - Intronic
1133298474 16:4767160-4767182 CGTGCGGGTGGGCCCGCAGGCGG + Exonic
1134057807 16:11181312-11181334 AGTGTGGGAAGGCCCACAGTGGG + Exonic
1203143050 16_KI270728v1_random:1781493-1781515 AGTGTGGGTGGATCCCCAGATGG + Intergenic
1203143185 16_KI270728v1_random:1782340-1782362 AGTGTGGGTGGATCCCCAGATGG + Intergenic
1160680076 19:408429-408451 AGTGGGGGGCGGCTGGCAGAGGG + Intronic
927846134 2:26473750-26473772 AGGGTGGGGCTGCCCGGAGAAGG + Intronic
929537526 2:42792824-42792846 TGTGTGGGGCGCCCCGGAGACGG - Intergenic
948401991 2:237691706-237691728 AGTAGGGGTCGACCCGAAGAGGG - Intronic
1180000704 21:44994085-44994107 AGTCTTGGTCGGCTGGCAGAGGG + Intergenic
1182474800 22:30571215-30571237 AGTGTGGGTGGCACAGCAGAAGG + Intronic
1183455758 22:37922288-37922310 GGGGTGGGGCGGCCCGCAGGGGG - Exonic
1183714267 22:39524549-39524571 AGTGGGGGTCGGCCCTCATTTGG + Intergenic
959026302 3:101243674-101243696 AGTGTGGCTTGGCCCACAGAAGG - Exonic
963600424 3:147373552-147373574 AGGGTGGGGTGGCCAGCAGATGG - Intergenic
963603668 3:147396965-147396987 AGCGTGGGTCGGCAAGCAGCCGG - Intronic
965659851 3:171029600-171029622 AGTGTGGCTGGGCCCACGGAAGG - Intergenic
968963433 4:3757440-3757462 AGTGTGGGCAGGCCCACAGGTGG - Intergenic
969004635 4:4009481-4009503 ACTGTGGGTAGCCCCACAGATGG + Intergenic
969625367 4:8302234-8302256 AGTGTGGCTCGCCCCACAGGTGG - Intronic
970281902 4:14465853-14465875 AGAGTGGGTCTGCTAGCAGACGG - Intergenic
995380701 5:111530398-111530420 AGTGTGGGTGAGTCAGCAGAAGG - Intergenic
1001686045 5:173595798-173595820 ACTGTGGCTCTGCTCGCAGAGGG + Intergenic
1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG + Exonic
1013180345 6:107712070-107712092 AGTGTGGATCGGCATTCAGATGG - Intronic
1015314909 6:131807478-131807500 AGTGGGGGACGGGGCGCAGAGGG + Intergenic
1017524753 6:155232689-155232711 AGAGTGGGTCGGCATGCGGAGGG + Intronic
1020324772 7:6965980-6966002 ACTGTGGGCAGCCCCGCAGATGG + Intergenic
1028058759 7:86282449-86282471 AGTCTGGGTGGGCCCGCACTCGG - Intergenic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038612256 8:29068142-29068164 AGTGTGGGTCGGCCCGCAGATGG - Exonic
1053313467 9:37034341-37034363 AGTGTGGGGCGGCGCGCTGGGGG - Intergenic
1057839561 9:98474759-98474781 AGTGAGGGTCTGTCCACAGAAGG + Intronic
1185549483 X:971856-971878 AGTGTGGGTGGATCCCCAGATGG - Intergenic