ID: 1038612256

View in Genome Browser
Species Human (GRCh38)
Location 8:29068142-29068164
Sequence AGTGTGGGTCGGCCCGCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612256_1038612272 28 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612256_1038612262 -6 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612256_1038612271 25 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612271 8:29068190-29068212 GGAGCGCATCGGGAGTCCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 25
1038612256_1038612273 29 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612273 8:29068194-29068216 CGCATCGGGAGTCCTAAGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1038612256_1038612263 -5 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612263 8:29068160-29068182 ACACTAAGGTGCCACTCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1038612256_1038612267 14 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612256_1038612261 -7 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612261 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1038612256_1038612268 15 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612256_1038612264 4 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612256 Original CRISPR AGTGTGGGTCGGCCCGCAGA TGG (reversed) Exonic