ID: 1038612259

View in Genome Browser
Species Human (GRCh38)
Location 8:29068157-29068179
Sequence CAGGAGTGGCACCTTAGTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612259_1038612279 26 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612279 8:29068206-29068228 CCTAAGGCGGGTGGGCGGGCAGG 0: 1
1: 0
2: 1
3: 25
4: 224
1038612259_1038612267 -1 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612259_1038612271 10 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612271 8:29068190-29068212 GGAGCGCATCGGGAGTCCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 25
1038612259_1038612277 22 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612277 8:29068202-29068224 GAGTCCTAAGGCGGGTGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 141
1038612259_1038612274 17 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612274 8:29068197-29068219 ATCGGGAGTCCTAAGGCGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1038612259_1038612272 13 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612259_1038612275 18 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612275 8:29068198-29068220 TCGGGAGTCCTAAGGCGGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 44
1038612259_1038612268 0 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612259_1038612276 21 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612276 8:29068201-29068223 GGAGTCCTAAGGCGGGTGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 170
1038612259_1038612273 14 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612273 8:29068194-29068216 CGCATCGGGAGTCCTAAGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612259 Original CRISPR CAGGAGTGGCACCTTAGTGT GGG (reversed) Exonic