ID: 1038612262

View in Genome Browser
Species Human (GRCh38)
Location 8:29068159-29068181
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612256_1038612262 -6 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612251_1038612262 8 Left 1038612251 8:29068128-29068150 CCCGGCCTTGGGTGCCATCTGCG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612249_1038612262 13 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612250_1038612262 12 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612252_1038612262 7 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
1038612255_1038612262 3 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612262 8:29068159-29068181 CACACTAAGGTGCCACTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type