ID: 1038612264

View in Genome Browser
Species Human (GRCh38)
Location 8:29068169-29068191
Sequence TGCCACTCCTGGGGCCTTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 280}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612250_1038612264 22 Left 1038612250 8:29068124-29068146 CCTTCCCGGCCTTGGGTGCCATC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612249_1038612264 23 Left 1038612249 8:29068123-29068145 CCCTTCCCGGCCTTGGGTGCCAT 0: 1
1: 0
2: 0
3: 16
4: 202
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612255_1038612264 13 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612256_1038612264 4 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612251_1038612264 18 Left 1038612251 8:29068128-29068150 CCCGGCCTTGGGTGCCATCTGCG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612258_1038612264 -7 Left 1038612258 8:29068153-29068175 CCGACCCACACTAAGGTGCCACT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1038612252_1038612264 17 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612264 8:29068169-29068191 TGCCACTCCTGGGGCCTTCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612264 Original CRISPR TGCCACTCCTGGGGCCTTCC AGG Exonic