ID: 1038612267

View in Genome Browser
Species Human (GRCh38)
Location 8:29068179-29068201
Sequence GGGGCCTTCCAGGAGCGCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612251_1038612267 28 Left 1038612251 8:29068128-29068150 CCCGGCCTTGGGTGCCATCTGCG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612258_1038612267 3 Left 1038612258 8:29068153-29068175 CCGACCCACACTAAGGTGCCACT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612252_1038612267 27 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612255_1038612267 23 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612259_1038612267 -1 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612256_1038612267 14 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115
1038612260_1038612267 -2 Left 1038612260 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1038612267 8:29068179-29068201 GGGGCCTTCCAGGAGCGCATCGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612267 Original CRISPR GGGGCCTTCCAGGAGCGCAT CGG Exonic