ID: 1038612268

View in Genome Browser
Species Human (GRCh38)
Location 8:29068180-29068202
Sequence GGGCCTTCCAGGAGCGCATC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612260_1038612268 -1 Left 1038612260 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612252_1038612268 28 Left 1038612252 8:29068129-29068151 CCGGCCTTGGGTGCCATCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612258_1038612268 4 Left 1038612258 8:29068153-29068175 CCGACCCACACTAAGGTGCCACT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612259_1038612268 0 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612255_1038612268 24 Left 1038612255 8:29068133-29068155 CCTTGGGTGCCATCTGCGGGCCG 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612251_1038612268 29 Left 1038612251 8:29068128-29068150 CCCGGCCTTGGGTGCCATCTGCG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1038612256_1038612268 15 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612268 8:29068180-29068202 GGGCCTTCCAGGAGCGCATCGGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612268 Original CRISPR GGGCCTTCCAGGAGCGCATC GGG Exonic