ID: 1038612272

View in Genome Browser
Species Human (GRCh38)
Location 8:29068193-29068215
Sequence GCGCATCGGGAGTCCTAAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612256_1038612272 28 Left 1038612256 8:29068142-29068164 CCATCTGCGGGCCGACCCACACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612266_1038612272 -6 Left 1038612266 8:29068176-29068198 CCTGGGGCCTTCCAGGAGCGCAT 0: 1
1: 0
2: 1
3: 15
4: 164
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612258_1038612272 17 Left 1038612258 8:29068153-29068175 CCGACCCACACTAAGGTGCCACT 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612265_1038612272 -1 Left 1038612265 8:29068171-29068193 CCACTCCTGGGGCCTTCCAGGAG 0: 1
1: 0
2: 4
3: 48
4: 405
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612260_1038612272 12 Left 1038612260 8:29068158-29068180 CCACACTAAGGTGCCACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79
1038612259_1038612272 13 Left 1038612259 8:29068157-29068179 CCCACACTAAGGTGCCACTCCTG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1038612272 8:29068193-29068215 GCGCATCGGGAGTCCTAAGGCGG 0: 1
1: 0
2: 0
3: 0
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612272 Original CRISPR GCGCATCGGGAGTCCTAAGG CGG Exonic