ID: 1038612514

View in Genome Browser
Species Human (GRCh38)
Location 8:29069294-29069316
Sequence GCCCCCAGGCCCACCGTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612514_1038612517 -8 Left 1038612514 8:29069294-29069316 CCATGCACGGTGGGCCTGGGGGC 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1038612517 8:29069309-29069331 CTGGGGGCGTGGCTGCTGTGAGG 0: 1
1: 0
2: 2
3: 38
4: 458
1038612514_1038612519 -2 Left 1038612514 8:29069294-29069316 CCATGCACGGTGGGCCTGGGGGC 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1038612519 8:29069315-29069337 GCGTGGCTGCTGTGAGGGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 264
1038612514_1038612518 -7 Left 1038612514 8:29069294-29069316 CCATGCACGGTGGGCCTGGGGGC 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1038612518 8:29069310-29069332 TGGGGGCGTGGCTGCTGTGAGGG 0: 1
1: 0
2: 3
3: 32
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612514 Original CRISPR GCCCCCAGGCCCACCGTGCA TGG (reversed) Exonic
900142174 1:1143320-1143342 GCCCCCAGCCCCACACTGCCTGG + Intergenic
900173921 1:1283804-1283826 GACCCCAGGCCTCCCCTGCAGGG + Intronic
900243360 1:1627066-1627088 GCCCCCAGGCTCACTGAGCGTGG + Exonic
900584197 1:3424685-3424707 GCCCCCAAGCCCTCCATGAATGG + Intronic
900596179 1:3481197-3481219 GGCACCAGGCCCCCTGTGCATGG + Intergenic
900606295 1:3525124-3525146 ACCCACAGGCTCCCCGTGCAAGG + Intronic
901381634 1:8878467-8878489 GCCCGCAGGCCCAGCGTGGCGGG - Intronic
902878147 1:19353213-19353235 CTCCCCAGGCCCACAGTGCCAGG - Intronic
903449175 1:23441330-23441352 CCCCCAAGGCCCACCGTGGAGGG - Intronic
903658026 1:24960734-24960756 GCCCCCAGTGGAACCGTGCATGG + Intronic
904391744 1:30190535-30190557 GGTCCCAGGCCCACAGTCCAAGG - Intergenic
904593929 1:31631173-31631195 GCTCCCAGGACCACCTTGCCTGG + Intronic
904675669 1:32197931-32197953 GCCCTCAGGGCCACCGTGATGGG - Exonic
904762883 1:32817973-32817995 GCCCCCACCCCCACTGGGCAGGG - Exonic
904940886 1:34164487-34164509 GCCCCCAGGACCAGCGTGCCTGG + Intronic
905240154 1:36576164-36576186 CCCCCAAGGCCCACCATGGAAGG - Intergenic
905241240 1:36582967-36582989 TCCCCCAGGCCCATCCTCCAGGG + Intergenic
905635854 1:39551718-39551740 GCCACCACGCCCAGCCTGCAGGG - Intergenic
905910143 1:41647911-41647933 GGTCCCAGGCCCACCAGGCAGGG - Intronic
906298281 1:44662489-44662511 GGCCCCAGGCCAACCTTGCTGGG + Intronic
906492397 1:46278710-46278732 GCCTCCAGGACCTCAGTGCAAGG + Exonic
907373611 1:54018405-54018427 GCCCCAAGTCTCACAGTGCATGG + Intergenic
909413367 1:75378895-75378917 GCCCCCAGCACCACAGGGCAGGG + Intronic
909726373 1:78840879-78840901 GCCCCCAGGCCCAGGCAGCAAGG + Intergenic
912863155 1:113232763-113232785 GCCCCCAGTACCACCCTGTATGG + Intergenic
913282540 1:117199918-117199940 GCCACCACGCCCAGCCTGCAGGG + Intronic
914918843 1:151834168-151834190 ACCCCCAGGCCCTCCCTGAAAGG - Intergenic
915402521 1:155634014-155634036 GCCCCCAGCACCACAGGGCAGGG - Intergenic
915909957 1:159908761-159908783 GCCCCCAGGTTCTCCCTGCACGG + Intergenic
916009575 1:160692586-160692608 GCCCCCAGCACCACAGGGCAGGG + Intronic
917509062 1:175655141-175655163 GCCACCATCCCCACCCTGCAAGG - Intronic
917967035 1:180185408-180185430 GGCCCCAGGCCCATCATGCTGGG - Intronic
920180934 1:204131360-204131382 GCCCTCAGGCCCTCCTTCCAGGG - Exonic
920247926 1:204602341-204602363 GCCCCCAGGCCCAAGGAGCCAGG - Intergenic
920507421 1:206526338-206526360 GCCTCCAGGCCCTCCGGGCTGGG + Intronic
924626851 1:245702666-245702688 GCCCCTAGGCCCTCTGTGCTGGG + Exonic
924732384 1:246724169-246724191 GCCCCCAGGGCCACCGCCCTAGG + Exonic
924945942 1:248847044-248847066 CCCCACAGGCTCACGGTGCAGGG + Exonic
1067045036 10:42980718-42980740 GCACCCAGGGCCACAGGGCAAGG + Intergenic
1067068947 10:43118874-43118896 GACCCCAGCCCCGCCCTGCATGG + Intronic
1067408752 10:46046677-46046699 CCCACCAGGCCCACCGGGCCTGG + Intergenic
1068083379 10:52346900-52346922 GGCCCCAGCTCCACCGTCCAGGG - Intergenic
1072609194 10:97005174-97005196 TCCCCAAGGCCCACAGGGCAAGG - Intronic
1072947916 10:99827095-99827117 GCCCCCAGCACCACAGGGCAGGG - Intronic
1075330422 10:121570071-121570093 CCCCCCAAGCCCAGCCTGCAGGG + Intronic
1076786818 10:132754068-132754090 GCCCCCATGCCAGCCATGCAGGG + Intronic
1076850139 10:133088580-133088602 GCCCCCAGGCCGCCCGCGGAGGG + Intronic
1077020789 11:416372-416394 GCCCCCAGGTCCACCGTCCAGGG + Intronic
1077166011 11:1139236-1139258 TCCCCCAGCCACCCCGTGCAAGG - Intergenic
1077240332 11:1507342-1507364 GCCCCCAGCCCCACCGCCGATGG - Intergenic
1077416722 11:2427390-2427412 GCCCACAGGCACACCCTGCAAGG - Intergenic
1077621975 11:3733596-3733618 GCCACCATGCCCACTGTGCCCGG + Intronic
1078535629 11:12171092-12171114 GCCACCATCCCCACCCTGCAGGG - Intronic
1078656413 11:13244783-13244805 TACCCCATGCCCACCGTGCCAGG + Intergenic
1080646709 11:34193068-34193090 GCCCCCAGGCACAACCAGCAAGG + Intronic
1081905184 11:46664718-46664740 GCCCACATGCCCACAGTGCAGGG - Intronic
1083202793 11:61130671-61130693 GCCCCAAACCCCACAGTGCAGGG + Exonic
1083781226 11:64918866-64918888 CCGCCCTGGCCCACCGGGCAGGG + Intronic
1084173455 11:67411368-67411390 TCACCCAGGCCCACAGTGAAAGG + Intronic
1084268770 11:68018315-68018337 GCCCTGAGGCCGACCTTGCAGGG - Intronic
1084332194 11:68436827-68436849 GCCCCCCAGCCCACCATGCAGGG - Intronic
1084432929 11:69121683-69121705 GCTCCCAGGACCCCCGTGCAGGG - Intergenic
1084464161 11:69312592-69312614 TCCCCCAGGCCCAGCCTGCCCGG - Intronic
1084646952 11:70464320-70464342 GCACCGAGGCCCACAGTGGAGGG - Intergenic
1084960132 11:72712255-72712277 GCCCCCAGGCGGCCCGTCCATGG + Exonic
1085205803 11:74731301-74731323 GACCCCGAGCCCACCGAGCAGGG - Intronic
1085297692 11:75440128-75440150 GCCCCCAGGCCCACAGCGCCTGG - Intronic
1085533219 11:77203684-77203706 GCCCCGAGGCACACAGAGCAGGG + Intronic
1087723908 11:101696872-101696894 GCCCCCAGCACCACAGGGCAGGG + Intronic
1089443683 11:118534950-118534972 GCCCCCATGCCTACTGTACAAGG - Exonic
1089471930 11:118728343-118728365 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1089556551 11:119318516-119318538 GAGCCCAGGCCCACCGGGCCAGG + Intronic
1091196087 11:133731848-133731870 GCCCCCAGGCTCACATTGCTTGG - Intergenic
1091330759 11:134729362-134729384 GGTTCCAGGCCCACTGTGCATGG - Intergenic
1091774412 12:3175103-3175125 GCCCCCAGCCTCGCCCTGCAGGG - Intronic
1091799136 12:3313748-3313770 GCCCACAGGGCCACCATGGATGG - Intergenic
1096404038 12:51329819-51329841 GCCCCCAGAGTCACCCTGCAGGG + Exonic
1096523768 12:52198718-52198740 GCCCCTCGGCCCTCCCTGCAAGG - Intergenic
1097273731 12:57796414-57796436 TCCCCCAGGCTCATCGTCCAGGG - Exonic
1097331273 12:58335084-58335106 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1101960528 12:109246170-109246192 GCCACCATGCCCACCTGGCAAGG - Exonic
1102813234 12:115841967-115841989 GCCACCATGCCCAGCCTGCATGG - Intergenic
1103933119 12:124460956-124460978 GGCCCAAGGCCCAGCTTGCAGGG + Intronic
1104710305 12:130980971-130980993 GACCCCAGGCCCACGCTGCGGGG - Intronic
1104760832 12:131296832-131296854 GACCCCAGCTCCACCGCGCATGG + Intergenic
1104847573 12:131854414-131854436 GCCCCCAGGCCCAGGAGGCAGGG + Intergenic
1104956196 12:132466985-132467007 AACCCCAGGCCAGCCGTGCAGGG + Intergenic
1105766049 13:23560490-23560512 GCCCCAAGGCCCACTATACATGG - Intergenic
1105851589 13:24340434-24340456 GACCCCAGGCCCAGCGAGAACGG - Intergenic
1106760057 13:32859211-32859233 GCTCCCAGGCCCACGGTGCCAGG - Intergenic
1108179645 13:47828189-47828211 GCCCCCAGGGCCAATTTGCATGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117340667 14:54788821-54788843 GCTGGGAGGCCCACCGTGCATGG + Intronic
1118615912 14:67574368-67574390 GGCACCAAGCCCACCGTGAAGGG + Exonic
1119399010 14:74349280-74349302 GCCTCCAGGGCCACCGGGGAGGG + Intronic
1119480233 14:74954254-74954276 GCCCCCAGGCCAACCCTGCTGGG + Intronic
1120953487 14:90062164-90062186 GCCCCCAGGCCCACGGCACCGGG - Exonic
1121495270 14:94387957-94387979 GCCCAGAGGTCCACGGTGCATGG + Intronic
1121892040 14:97603420-97603442 GCACCCAGTCCCACCCTACAGGG + Intergenic
1122284312 14:100641818-100641840 GCCCCCATGCCCAGCAGGCAGGG - Intergenic
1122297327 14:100712834-100712856 GTCCCCAGGGCCACCCAGCAGGG + Intergenic
1122363940 14:101183352-101183374 GGCCCCAGGCCCAGGCTGCAGGG + Intergenic
1122778003 14:104131310-104131332 GGCCCCAAGCCCAGCCTGCAAGG - Intergenic
1122885109 14:104707399-104707421 ACCCCCAAGCCCAGCGTGGAGGG + Exonic
1123408489 15:20039286-20039308 GCCACCATGCCCAGCCTGCAGGG - Intergenic
1123827897 15:24101613-24101635 GCCCCCAAGCCCAGCCTGCGCGG - Intergenic
1123842356 15:24261024-24261046 GCCCCCAAGCCCAGCCTGCGCGG - Intergenic
1123857385 15:24427083-24427105 GCCCCCAAGCCCAGCCTGCGTGG - Intergenic
1123862016 15:24477615-24477637 GCCCCCAAGCCCAGCCTGCGCGG - Intergenic
1126101346 15:45120039-45120061 GCCCCCAGGCCCTCCCTCCCTGG + Intronic
1128551337 15:68599867-68599889 GACCCCAGGCCCACAGAGCCTGG - Intronic
1129463088 15:75709772-75709794 GCCGCCTGGCCCACCTGGCATGG + Intronic
1129721796 15:77881629-77881651 GCCGCCTGGCCCACCTGGCATGG - Intergenic
1132016351 15:98320806-98320828 GCCTCCAGGTCCCCCGTGCCAGG + Intergenic
1132205937 15:99986144-99986166 CCCCCCTGCCCCACCCTGCAAGG - Intronic
1132402622 15:101522763-101522785 GCCCCCACGCCCACCCTCCAGGG + Intronic
1132575300 16:661198-661220 TCTCCCAGGGCCACCGTGCCCGG + Intronic
1132670231 16:1099540-1099562 GCTCTCAGGCCCACCTTTCAGGG + Intergenic
1136415124 16:30098233-30098255 GCCACAAGGCCCACAGGGCAGGG - Intergenic
1136598171 16:31265931-31265953 ACCCCCAGCCCCACCATGCGTGG - Intronic
1136983955 16:35082993-35083015 GTCCCCAGGCCACCCCTGCATGG + Intergenic
1137617114 16:49855066-49855088 CCACCGAGGCCCACCGGGCAGGG - Intronic
1139962127 16:70724105-70724127 CCCCCTAGGCACACTGTGCAGGG + Intronic
1140056939 16:71533754-71533776 GCCCCCATGCCCAGCCTGGAGGG - Intronic
1141692044 16:85602069-85602091 GATCCCAGCCCCACCGTCCAGGG + Intergenic
1141732109 16:85829786-85829808 GCCCCGGGGGCCACCGTGCAGGG + Intergenic
1142076530 16:88121098-88121120 ACCCCCCATCCCACCGTGCATGG - Intergenic
1142189597 16:88711827-88711849 CCCACCAGGCCCTCAGTGCAGGG - Intronic
1142599654 17:1047402-1047424 GCCCTCAGAGCCACCGTGGATGG - Intronic
1142618117 17:1148469-1148491 GTCCCCAGCCCCCCCGGGCATGG + Intronic
1143178066 17:4967916-4967938 GATCCCAGGCCCGCGGTGCATGG + Intergenic
1144727302 17:17508259-17508281 GCCCCCAGGCTCACCGGCCATGG - Intronic
1144830501 17:18128423-18128445 GCCCCCAGGATCACCTTGCTGGG - Intronic
1144854543 17:18260762-18260784 GCCCCCAGGGTCACCGGGCTCGG + Intronic
1146162351 17:30566717-30566739 GCCTCCAGACCCCCCTTGCAGGG - Intergenic
1146256305 17:31392923-31392945 GGCCCCAGGCCCCCCATGCAGGG - Intronic
1146661249 17:34666420-34666442 CCGCCCAGGCCCACCGAGCAGGG - Intergenic
1147215856 17:38898638-38898660 TTCCCCAGGCCCACCCTGGAGGG - Intronic
1147870192 17:43581765-43581787 GACCGCAGGCCCACCCAGCAGGG - Intergenic
1148226386 17:45900657-45900679 TCCCCCAGGTCCCCAGTGCAGGG + Intronic
1148480120 17:47954494-47954516 GCCCCAAGCCCCACCCTGCAAGG - Intronic
1149772514 17:59332314-59332336 GCGCCCAGTCCCACAGTGGAAGG - Intronic
1151658273 17:75505779-75505801 GGCCCCAGGCCCCCTGGGCAGGG + Intronic
1152122336 17:78426488-78426510 GCCGCCAGGCCCATCATGGAGGG + Exonic
1152892622 17:82891064-82891086 GCCCCAGGGCCCACCCAGCACGG - Intronic
1152988418 18:340407-340429 GTCCCCAGGCCCACGGTTCTGGG + Intronic
1153524107 18:5978823-5978845 GCACCCAGGCCTACGGTGGAGGG + Intronic
1154304348 18:13218959-13218981 GCCCCCAGGCCCACCCGGGGCGG - Intronic
1155874220 18:31064968-31064990 GCCCCCAGACACACACTGCATGG + Exonic
1155954081 18:31942793-31942815 GCCCTCCGGCCCACCCTGCGAGG + Exonic
1157820023 18:50760419-50760441 GCCCACAGCCCCTCCCTGCAAGG + Intergenic
1157866966 18:51196445-51196467 GCCCCCAAGTCCACCGCGAAGGG - Intronic
1161006879 19:1941454-1941476 GCGCCCAGGGCCAGGGTGCAGGG - Intronic
1161558477 19:4957663-4957685 GCCCCAAGGCCCACAGCACAGGG - Intronic
1161571126 19:5031398-5031420 GGCCCCAAGTGCACCGTGCACGG - Intronic
1161683513 19:5692194-5692216 GCCCCCAGGCCAAGCGCGCAGGG - Exonic
1161975930 19:7607746-7607768 GCCCCCAAGCCCACCTTGGGGGG - Intronic
1162144234 19:8603819-8603841 ACCCTTGGGCCCACCGTGCAGGG + Exonic
1163105962 19:15123225-15123247 GCCGCCACGCCCACCGTCCCTGG + Exonic
1164371171 19:27645590-27645612 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1164798734 19:31058155-31058177 GCTCCAAGGCCCAGGGTGCAGGG + Intergenic
1164931717 19:32180806-32180828 GCCCCCAGACCCCACCTGCATGG + Intergenic
1165385986 19:35510928-35510950 GCCCTCACACCCATCGTGCAGGG + Intronic
1166389896 19:42402969-42402991 GCCCCAGGGCCCACTGGGCACGG - Exonic
1166679237 19:44757185-44757207 GCCTCCAGGTCCAACGTGCCCGG - Exonic
1166786454 19:45370218-45370240 GCCGCCAGGCTCAACGTGGACGG - Exonic
1166951095 19:46428532-46428554 GCCCCCAGCCCCTGCCTGCAGGG + Intergenic
1167115568 19:47487452-47487474 CTCCCCAGGCCCACCGTCCCTGG + Intergenic
925191172 2:1884973-1884995 GCCGCCAAGCCCAACGTGAAGGG + Intronic
927519799 2:23691868-23691890 GCCCCCGGGCTCACCGAGAAAGG - Exonic
928127189 2:28625119-28625141 GCCCCCAGGCCACCCCTGAAAGG + Intronic
928318705 2:30266458-30266480 GGTCCCAGCCCTACCGTGCAGGG + Intronic
928322720 2:30296151-30296173 AGCCCCCGGCCCACCCTGCAGGG + Intronic
930110592 2:47675566-47675588 GCCCCCAGGCCCAGCTGCCAAGG + Intergenic
932625567 2:73293348-73293370 GCCCCCAAGCCCAGCGGGCGAGG - Exonic
933764261 2:85696147-85696169 TCCCCCAGGATCACTGTGCAAGG - Intronic
934300647 2:91774319-91774341 GGCCCCAGGCCCACCAAGCCTGG + Intergenic
934686418 2:96325250-96325272 CCCCCGTGGCCCAGCGTGCAGGG - Intergenic
934754660 2:96816677-96816699 GCCCCCAGGCCCAGAGCCCAGGG - Exonic
934981457 2:98846568-98846590 GCCCCCAGTCACAGCGTGAAGGG + Intronic
935709191 2:105882095-105882117 GCACACAGACCCACCGCGCAAGG - Intronic
936013098 2:108937805-108937827 CCCCGCAGGTCCACTGTGCATGG - Intronic
937247268 2:120501815-120501837 GGCCCCAGGCCCACAGCGGAGGG + Intergenic
938307428 2:130265235-130265257 GCCCCCGTGTCCACAGTGCACGG - Intergenic
938447905 2:131391607-131391629 GCCCCCGTGTCCACAGTGCACGG + Intergenic
942051638 2:172146209-172146231 GCACCCAGGCGCACCTTCCAGGG - Intergenic
947719857 2:232363738-232363760 GCCCCCAGCCCCACCTGGCCTGG + Intergenic
948541747 2:238696215-238696237 GCCTCCAGGCCCCCCGAGCAGGG - Intergenic
948711967 2:239830876-239830898 GACCCCAAGCCCACCTGGCAGGG + Intergenic
948788600 2:240365673-240365695 GCCCCCAAGCCCGCCCTGCGAGG - Intergenic
1169165831 20:3423223-3423245 GCCTCCTGACCCAGCGTGCAAGG - Intergenic
1169343690 20:4814179-4814201 GGCCTCAGGCCCTCCCTGCAGGG - Intronic
1170343076 20:15351108-15351130 GCCCCCACCCCCACCCTACAAGG - Intronic
1172104867 20:32510893-32510915 GGCCCCAGGTCCACCCTCCAAGG + Intronic
1172230544 20:33333052-33333074 GTCCCCAGGCCCACAAGGCATGG + Intergenic
1172408198 20:34704520-34704542 GCCCCCAGGCCCACCCGGGTCGG - Intronic
1172772886 20:37391978-37392000 ACCCCCAAGGCCACCCTGCAAGG - Intronic
1174786565 20:53438378-53438400 GCCACCAAGCCCAGCCTGCAAGG + Intronic
1175290697 20:57873196-57873218 GCCCCCATGCCCACAGTGAGAGG - Intergenic
1175366919 20:58461874-58461896 GCCCTGAGGCCCACCTTACATGG - Intronic
1175472178 20:59238227-59238249 GGCCCCAGGCCGACTGAGCAGGG - Intronic
1177248961 21:18567977-18567999 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1179513260 21:41889113-41889135 GACCTCAGGCCCTACGTGCAGGG + Exonic
1179515514 21:41903758-41903780 GCCCCCAGGCTCACCTGCCACGG - Intronic
1180025644 21:45160117-45160139 GCCTCCAGGCCCATCGGGTAGGG + Intronic
1180816514 22:18792818-18792840 GGCCCCAGGCCCACCAAGCCTGG - Intergenic
1180832615 22:18913661-18913683 TACCCCAGCCCCACCTTGCAGGG - Intronic
1180837916 22:18940483-18940505 GCCCCCAGCACCACAGGGCAGGG + Intergenic
1181202701 22:21227150-21227172 GGCCCCAGGCCCACCAAGCCTGG - Intronic
1181512025 22:23393461-23393483 TCCCCCAGGCCCACCAGGGACGG - Intergenic
1181646339 22:24233342-24233364 ACCCCCAGCCCCAACCTGCAGGG - Intronic
1181699001 22:24609455-24609477 GGCCCCAGGCCCACCAAGCCTGG + Intronic
1182469571 22:30539867-30539889 GGCCCTGGGCCCACCCTGCAGGG + Intronic
1182508034 22:30799408-30799430 GCCGCCACGCCCAGCCTGCAAGG + Intronic
1183462012 22:37957007-37957029 GCTTTCAGGCCCACCCTGCAGGG - Intronic
1184035921 22:41918050-41918072 ACACACATGCCCACCGTGCAGGG - Intergenic
1184186821 22:42870309-42870331 GGCCCCAGGCCCACTGAGCCCGG + Exonic
1184640213 22:45866636-45866658 GCCCGCAGTCCCACAGTGCCCGG + Intergenic
1184785680 22:46670549-46670571 ACCCCCAGGCTCCCCGTGGAGGG - Intronic
1185120705 22:48968261-48968283 GCCCCCCGCCCCAGAGTGCAGGG - Intergenic
1185247837 22:49782546-49782568 GACCCAAGGCCCATCGTGCTGGG + Intronic
1185247887 22:49782829-49782851 GACCCAAGGCCCATCGTGCTGGG + Intronic
1185247923 22:49783025-49783047 GACCCAAGGCCCATCGTGCTGGG + Intronic
1185330877 22:50251566-50251588 GCCCCAAGGCCCACCCGGCCCGG + Intronic
1203224212 22_KI270731v1_random:68263-68285 GGCCCCAGGCCCACCAAGCCTGG + Intergenic
1203266614 22_KI270734v1_random:18529-18551 GGCCCCAGGCCCACCAAGCCTGG - Intergenic
1203282701 22_KI270734v1_random:138966-138988 TACCCCAGCCCCACCTTGCAGGG - Intergenic
949488794 3:4567533-4567555 GCCCCCAAGCCCACCGCACGTGG - Intronic
951080408 3:18445089-18445111 GCCCCCGGGCGCAGCGTGCCCGG - Intronic
952820016 3:37478239-37478261 GCATCCAGGTCCACAGTGCACGG - Intronic
953454107 3:43028781-43028803 GCCTCCAGGGCCACAGGGCAGGG - Intronic
953923169 3:46966119-46966141 GCCCTCAGGACCTACGTGCAGGG + Intronic
954675671 3:52314079-52314101 GCCCCCACTCCCACCTTCCAGGG - Intergenic
954691243 3:52396789-52396811 TGCCCCAGGCCCACCTTGTAGGG - Exonic
955348058 3:58175439-58175461 GCCCCCAGGCCCACGGGGACCGG + Intergenic
958907520 3:99958455-99958477 GCACTCAGGCCCACCTTTCAAGG + Intronic
960028163 3:113031612-113031634 GCCCCCAGCACCACAGGGCAGGG - Intergenic
961296900 3:125892103-125892125 GCCCCCAGCACCACAGGGCAGGG + Intergenic
961448413 3:126991767-126991789 GGCCCCAGGCCCACTAAGCAAGG + Intronic
963696026 3:148566746-148566768 GCCCCCAGCACCACAGGGCAGGG - Intergenic
967026595 3:185569900-185569922 GCCCCCAGCACCACAGGGCAGGG - Intergenic
968495812 4:914721-914743 GCACTCAGCCCCAGCGTGCAAGG + Intronic
968495904 4:915115-915137 GCACTCAGCCCCAGCGTGCACGG + Intronic
968656054 4:1778914-1778936 GCCCCCAGGACCTCAGGGCATGG + Intergenic
968761020 4:2442851-2442873 GCCCCCAAGGCCACCGCGCAGGG - Intronic
968811749 4:2803162-2803184 GTCCCAAGGCCCACCCTGTAGGG + Intronic
969134522 4:5019577-5019599 GCCAGCACGCCCACCGGGCAGGG + Intergenic
969485573 4:7470740-7470762 GGCCCCAGCCCCAGCCTGCATGG + Intronic
970691967 4:18630699-18630721 GCCCCCAGCCCTGCCCTGCAGGG + Intergenic
976897333 4:90127969-90127991 GCGCCCAGGCCCGGCGTGCTCGG + Intronic
982876761 4:160660428-160660450 GCCCCCAGCACCACAGGGCAGGG + Intergenic
985145163 4:186889055-186889077 GCCCCGGGGCCCACGGTGCTGGG + Intergenic
985608686 5:873644-873666 GCCTCCTGGCCCACCTTGCTTGG + Intronic
988717282 5:33840737-33840759 ATCCCCAGGGCCACCCTGCAGGG + Intronic
990346864 5:54880211-54880233 GACCCCATGTCCACTGTGCAAGG + Intergenic
995511311 5:112912701-112912723 TCCTCCATGCCCACCATGCATGG + Intronic
999440591 5:151597556-151597578 CACCCAAGGCCCACAGTGCAGGG + Intergenic
999952427 5:156665054-156665076 GCCCCCAGCACCACAGGGCAGGG - Intronic
1001732538 5:173971094-173971116 GCCCCCTGGCTCACTGTGCCCGG - Intergenic
1002705731 5:181160091-181160113 TCCCCCAGGCCCAACTTTCAGGG + Intergenic
1003074417 6:2971168-2971190 GCGCCCAGGCCCAGCGCCCACGG - Intronic
1004338951 6:14790228-14790250 GCCCCCAGGGCCTCTGGGCATGG + Intergenic
1006101741 6:31689897-31689919 GCCCCCATCCCCACAGTGCGGGG - Intronic
1007337563 6:41164396-41164418 GCCCCCAGGCCCTTGGGGCAAGG - Intergenic
1007778591 6:44237988-44238010 GCCCCCAGCCCCACGGTTCTCGG - Intergenic
1009947097 6:70352729-70352751 GCCTACAGGCCCACCTTGCCTGG - Intergenic
1010592214 6:77724543-77724565 GCCCCCAGCACCACAGGGCAGGG - Intronic
1012858089 6:104527040-104527062 CCCCCCAGCCCCACCCTTCAGGG + Intergenic
1013170722 6:107634669-107634691 GCGCCCACGCCCGCCGAGCATGG + Exonic
1014653769 6:124073803-124073825 TCCCCCACCCCCACCGGGCAGGG + Intronic
1014849481 6:126323821-126323843 GCCACCAAGCCCAGCCTGCAGGG - Intergenic
1018160848 6:161041121-161041143 GCCACCAGGCCCTCCTTCCAGGG - Intronic
1019976888 7:4590066-4590088 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1019977823 7:4598569-4598591 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1021716925 7:23469586-23469608 CCCCCGAGGCCCAGCGTGCCGGG + Intronic
1022351060 7:29566311-29566333 GCCCCTAGGCCCTCCGGCCATGG + Exonic
1029260184 7:99296909-99296931 GCCCTCAGACTCACCCTGCAGGG - Intergenic
1029967172 7:104751959-104751981 GCCCCCAGCACCACAGGGCAGGG - Intronic
1030682907 7:112451268-112451290 CACCCCGGGCCCACCGCGCAAGG - Intronic
1032831218 7:135628457-135628479 GCCACCATGCCCAGCCTGCAAGG - Intronic
1034435068 7:151059564-151059586 GCCCCCCGGCGCACCGTGCGCGG - Intronic
1035125799 7:156607295-156607317 GGCTCCAGGCCCACCTTCCAGGG + Intergenic
1035205072 7:157289801-157289823 GCCCCCATGCCCCCTGGGCAGGG - Intergenic
1035302362 7:157906000-157906022 CCACCCAGGGCCCCCGTGCAGGG + Intronic
1035530494 8:346907-346929 GCCCCCAGCCCCACAGAGCCTGG - Intergenic
1035580933 8:738616-738638 GCCCCCCAGCCCTCCGCGCAGGG - Intergenic
1036292431 8:7505514-7505536 GCCCCCAGCACCACAGGGCAGGG - Intronic
1038612514 8:29069294-29069316 GCCCCCAGGCCCACCGTGCATGG - Exonic
1045035969 8:98176681-98176703 GGCCCCAGGGACACCGGGCACGG + Intergenic
1047251115 8:123182718-123182740 GCTCCCAGGACCGGCGTGCAGGG - Exonic
1048867419 8:138771096-138771118 GGCCCCAGGATCACAGTGCAGGG + Intronic
1048947396 8:139462130-139462152 GCCCCCAGCACCACAGGGCAGGG - Intergenic
1049234732 8:141506926-141506948 GCCCCCAGGAGCAGCCTGCAGGG - Intergenic
1049345100 8:142134495-142134517 GCCACCAGGACCCGCGTGCACGG + Intergenic
1049560821 8:143309301-143309323 GTCCCCAGGCCGGCCGGGCACGG - Intronic
1049599312 8:143499728-143499750 GTCCCCAGGGCCTCCGTGGAGGG - Intronic
1049661748 8:143822614-143822636 GTCCCCAGGCCCACCTGGCTAGG - Intronic
1053147690 9:35722978-35723000 ACCCCCAGGCCCACAGTTCATGG - Intronic
1056214926 9:84397841-84397863 GCTCCCAGGCCCCCAGTTCAGGG + Intergenic
1057219473 9:93248217-93248239 TCCCCCCAGCCCACCATGCAGGG + Intronic
1060256450 9:122035154-122035176 CCCCTCAAGCCCACCCTGCAAGG + Intronic
1060603151 9:124891285-124891307 GCCACCAGGCCACCCATGCACGG + Intronic
1060894722 9:127210271-127210293 ACCCCCAGGCCCAACATGCAAGG + Intronic
1061003262 9:127914699-127914721 GGCTCCAGGCCCACTGTGCCGGG - Exonic
1061415665 9:130445575-130445597 GCCGCCAGCCCCACCGGGGAGGG - Intronic
1062356938 9:136169504-136169526 CCCCCCAGGCCCCTCATGCAGGG - Intergenic
1185783281 X:2867471-2867493 GGCCCCAGGCACAGCGTGAAGGG + Intronic
1186430684 X:9501828-9501850 AGCACCAGGCCCACCGTGAAAGG + Exonic
1186433453 X:9523645-9523667 GCCCCCAGCCCCACCCTTGACGG + Intronic
1189532637 X:41902074-41902096 GGACCCAGGCCCACCATCCATGG - Intronic
1190258731 X:48785034-48785056 GCCCACTGGCCCACCCTGGAGGG - Intergenic
1190874279 X:54448857-54448879 GCTCCCAGGCACCCCGTGCAAGG + Exonic
1196549478 X:117005592-117005614 GCTCCCAGGCCCACCCTGACAGG + Intergenic
1200072950 X:153537992-153538014 GTCCCCAAGGCCACAGTGCAGGG + Intronic