ID: 1038612847

View in Genome Browser
Species Human (GRCh38)
Location 8:29070686-29070708
Sequence GCTGCTGGTCAGGCCCAGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 487}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038612847_1038612857 20 Left 1038612847 8:29070686-29070708 CCCGGCTGGGCCTGACCAGCAGC 0: 1
1: 0
2: 3
3: 55
4: 487
Right 1038612857 8:29070729-29070751 GAAGTACTGCTTCCCGCCGATGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038612847 Original CRISPR GCTGCTGGTCAGGCCCAGCC GGG (reversed) Exonic
900005983 1:51752-51774 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
900142828 1:1145679-1145701 GCTGCAGGTCCGGCAGAGCCAGG + Intergenic
900176014 1:1291685-1291707 GCTGCTGGTCTGGCCCACCCTGG - Exonic
900347404 1:2216286-2216308 GACACTGGTGAGGCCCAGCCTGG - Intergenic
900408989 1:2504444-2504466 GCTGCGGCCCAGGCCCAGGCTGG - Exonic
900415427 1:2532452-2532474 GGTGCTGGCCAGGGCCTGCCTGG - Intergenic
900512299 1:3066502-3066524 GCTGCCGGTCAAGCCTCGCCAGG - Intergenic
900945240 1:5827528-5827550 GCTGGTGTTCCTGCCCAGCCTGG - Intergenic
901633761 1:10660199-10660221 GCTGCTGGGCAGCCGCAGGCCGG + Exonic
902955560 1:19922442-19922464 GCCCCTGGTCCAGCCCAGCCTGG - Intronic
903724315 1:25430043-25430065 GCTCCCGGTCCGGCCCGGCCCGG + Intronic
903811435 1:26036921-26036943 GCTGGATGCCAGGCCCAGCCAGG + Intergenic
904330623 1:29755794-29755816 GCAGCTGGTCTGGCCCAGCCTGG + Intergenic
904393869 1:30205064-30205086 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
904416051 1:30361801-30361823 ACAGCTGGTCTGGCCCAGCCTGG - Intergenic
905199540 1:36306749-36306771 GGTGCAGGTGAGGCCGAGCCAGG + Exonic
905703859 1:40040090-40040112 GCGGTGGGTCAGCCCCAGCCCGG - Intergenic
906663090 1:47596396-47596418 TTTGCTGCCCAGGCCCAGCCAGG - Intergenic
907293505 1:53433895-53433917 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
907899147 1:58721477-58721499 GCTCCTGGTCAGAGGCAGCCTGG + Intergenic
912924082 1:113897868-113897890 GCTGTATGTCAGGCCCTGCCCGG - Exonic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
913245043 1:116863780-116863802 GCTCCTTGCCAGGCCGAGCCAGG + Intergenic
915912364 1:159923026-159923048 GCTGCTGACCAGGCCTGGCCTGG - Intronic
917325390 1:173826110-173826132 GCTGCTGGGGAGGCCGAGGCAGG + Intronic
917741398 1:177964882-177964904 ACAGCTGGCCAGGCCCATCCTGG + Intronic
917967724 1:180189042-180189064 GCTGCCAGTGAGGACCAGCCAGG - Intronic
918502752 1:185216740-185216762 GCAGCAGTTCAGGACCAGCCTGG + Intronic
920370720 1:205477694-205477716 GCAGCTGGCCAGGCCAGGCCTGG - Intergenic
920373512 1:205494004-205494026 GCTGCTGTCCAGGGACAGCCAGG - Intergenic
920907919 1:210188953-210188975 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
922476058 1:225907619-225907641 CCCGCTGGTCATCCCCAGCCAGG - Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
922598889 1:226834911-226834933 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
922620785 1:226986739-226986761 GCTGCGGGCCACGCCCAGGCCGG + Exonic
922677325 1:227560939-227560961 GCTGGTGGCCAGGCCAAGCGTGG - Intergenic
924514067 1:244751697-244751719 GCTGGTGCTCAGCCCCAGCAAGG + Intergenic
1063106506 10:2997054-2997076 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1063138440 10:3236766-3236788 GCTGGTGTCCAGGCCCAGCAAGG + Intergenic
1064357270 10:14631195-14631217 GATGCTGCCCAGGCCCAGCCAGG - Intronic
1066103484 10:32137719-32137741 GCTCCTCGCCAGGCCTAGCCAGG - Intergenic
1066437448 10:35407293-35407315 GCTCCTTGCCAGGCCAAGCCAGG - Intronic
1067055807 10:43049235-43049257 GCTTCTGGACATGCCCAGTCAGG - Intergenic
1067297594 10:44983696-44983718 GCTGCTGGCCTGGCTAAGCCTGG + Intronic
1067803841 10:49379913-49379935 GTTGCAGGTAAGGCCCAGGCTGG - Intronic
1069629509 10:69889193-69889215 GCTGCTAGTGAGGCCCAGCGAGG + Intronic
1069658870 10:70110255-70110277 GCTGGTGCTGTGGCCCAGCCTGG + Intronic
1069779169 10:70944035-70944057 GCTGCAGGGCAGGCTCAGCGGGG - Intergenic
1070191393 10:74114856-74114878 GATGTTGGTCCGGCCCAGCATGG - Exonic
1070199579 10:74190803-74190825 GCTGCTTTTCAGGGCTAGCCTGG + Intronic
1070768849 10:79070756-79070778 GCTCCCGGGCAGGCGCAGCCGGG - Intronic
1070824140 10:79381050-79381072 GCTGCCAGTCGGGCCCAGCAAGG - Intergenic
1070825374 10:79387591-79387613 GAAGCTGGTCAGGGCCAGCCTGG + Intronic
1070841426 10:79490559-79490581 GCTGCTGGCGAGGCCAGGCCAGG + Intergenic
1071454351 10:85833070-85833092 GCAGCTGGGCAGGACCAGCAAGG + Intronic
1071896635 10:90075443-90075465 GCTGCAGGTCTGACCCAGCATGG - Intergenic
1072884436 10:99261260-99261282 GCTCCTTGCCAGGCCGAGCCAGG + Intergenic
1073030782 10:100524032-100524054 GCCTCTGGTCAGACCCAGCTGGG + Exonic
1073453252 10:103621876-103621898 GCTGAGGGTCAGGTCCAGCCAGG - Intronic
1073513904 10:104060473-104060495 CTTGGTGGCCAGGCCCAGCCAGG - Intronic
1074018937 10:109564001-109564023 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
1074084530 10:110198049-110198071 GCTACTGGTGAGGCCGAGGCAGG + Intergenic
1074182614 10:111077413-111077435 GCTGCGGTTCTGGCCCGGCCCGG - Exonic
1074353708 10:112762809-112762831 ACTGCTGTCCAGGCCCAGCACGG - Intronic
1074577455 10:114683811-114683833 GATGCTGAGCAGGACCAGCCGGG + Intronic
1075724170 10:124603235-124603257 TGGGCTGGGCAGGCCCAGCCCGG + Intronic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1076750117 10:132538132-132538154 GCTGCTGGTCACGGCCAACGTGG + Exonic
1076868238 10:133179883-133179905 GCTGACGGCCAAGCCCAGCCAGG + Intronic
1076995627 11:296263-296285 GCTGTGGGTCAGGGGCAGCCTGG + Intergenic
1077015031 11:395606-395628 GACGCTCGTGAGGCCCAGCCCGG - Intronic
1077250573 11:1558934-1558956 GATGCGGGTCAGGCCCACGCTGG + Exonic
1077424497 11:2467938-2467960 GCTGATGGGCTGGCCCAGCGTGG + Intronic
1077495080 11:2883063-2883085 GGTGTGGGCCAGGCCCAGCCAGG + Intergenic
1077501296 11:2910847-2910869 GGTCTTGTTCAGGCCCAGCCTGG + Intronic
1077679206 11:4223652-4223674 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1077688642 11:4320294-4320316 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1078444623 11:11394928-11394950 GAGGCTGGGCTGGCCCAGCCAGG + Intronic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1079115270 11:17636581-17636603 GCTCCTGGTCAGGTGCGGCCAGG - Intronic
1079365705 11:19807534-19807556 GCTGCAGGCCAATCCCAGCCTGG + Intronic
1079392831 11:20037050-20037072 GGTGCTGGTCAGTCCCAAACTGG - Intronic
1080457469 11:32429728-32429750 GCTGCTGGGGTGGCCCTGCCAGG - Intronic
1081036687 11:38156613-38156635 GAAGTTGGTCAGGCCCAGTCGGG + Intergenic
1081447324 11:43143336-43143358 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1081663953 11:44905649-44905671 GCTGCTTGCCAGGCACAGCCGGG - Intronic
1081906326 11:46672668-46672690 GCTGCAAGGCAGGCCCAGGCAGG - Exonic
1082761510 11:57131282-57131304 GCTCATGGTCAGCCTCAGCCTGG + Intergenic
1082898537 11:58219747-58219769 GATGCAGGACAGGCCTAGCCTGG - Intergenic
1083294080 11:61705955-61705977 GCTCCTGGGCCAGCCCAGCCTGG + Intronic
1083912161 11:65716519-65716541 GGAGTGGGTCAGGCCCAGCCAGG + Intronic
1084004195 11:66314634-66314656 CCTGCTCCCCAGGCCCAGCCAGG - Exonic
1084089735 11:66871651-66871673 CCTGCTGTCCAGGCCCAGCCAGG + Intronic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084392877 11:68890256-68890278 GCTCCTGGTCCCGCCCATCCCGG - Intergenic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085449847 11:76625200-76625222 GTGGCTGGGCAGGCCCAGGCAGG - Intergenic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1088049452 11:105493812-105493834 GCTGCAGGTCAAGAACAGCCAGG + Intergenic
1088903063 11:114133314-114133336 GGTGCTGGTCAGCCCCAGCAGGG + Intronic
1089208875 11:116787742-116787764 GCCGGGGGTCAGACCCAGCCAGG - Intronic
1089315835 11:117590702-117590724 ACTGCTGGTCAGGCTCTGCTGGG + Intronic
1089527670 11:119107694-119107716 GCAGCGGGTGAGCCCCAGCCGGG + Exonic
1089617377 11:119702509-119702531 GCTTCTGGTTGGGCCTAGCCTGG + Intronic
1090205254 11:124880271-124880293 GCTGCTCCTCAGCCCCAGGCTGG + Intronic
1091088396 11:132746002-132746024 ACAGCTGGACAGGCCCAGCAGGG + Intronic
1091171619 11:133524844-133524866 GCTGCTGGGCAGGCCAAACTGGG + Intronic
1092125403 12:6071878-6071900 GCAGTAGGCCAGGCCCAGCCTGG - Intronic
1095559227 12:43545721-43545743 GCTGCTGGGCAGTCCAAGCAAGG - Intronic
1095963616 12:47851630-47851652 GCTACTGGGCTGGCCCACCCTGG + Intronic
1095991215 12:48035841-48035863 ACTGGTAGTCAGGGCCAGCCAGG - Intergenic
1096227813 12:49877673-49877695 GCTGTGGGTCTGGCCCAGGCTGG + Intronic
1096269860 12:50156290-50156312 GCTGCTGGGGAGGCCAAGGCAGG + Intronic
1101418144 12:104526763-104526785 GTGGGTGATCAGGCCCAGCCAGG + Intronic
1102116895 12:110409724-110409746 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1102905376 12:116670544-116670566 GCTGCAGCTCAGGACCAGCCTGG + Intergenic
1103620542 12:122184616-122184638 GCTGCGGACCAGGCCCAGCAGGG - Exonic
1104672422 12:130689856-130689878 GCGTCTGGGCAGGCTCAGCCAGG + Intronic
1104966256 12:132509953-132509975 GCGGCTGGGCTGGCCCAGCAGGG - Intronic
1105384044 13:19913693-19913715 TCTGTTGGCCAGGCCCAGGCTGG - Intergenic
1105887188 13:24652161-24652183 GCTGCAAGTCAGGCCCTGACAGG + Intergenic
1106361941 13:29039053-29039075 GATGCTGGATAGACCCAGCCAGG + Intronic
1106412234 13:29518649-29518671 GCTTCTGCTAAGGCTCAGCCCGG + Intronic
1106512733 13:30425265-30425287 CATGCTGGCCAGGACCAGCCAGG - Intergenic
1108267957 13:48731078-48731100 GCTGCTGCTGAGGCCCAGGGAGG + Intergenic
1108282156 13:48871191-48871213 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1108512909 13:51171547-51171569 GCTCCTGGCCAGGCCGAGCTAGG + Intergenic
1108714128 13:53061966-53061988 GCTCCTGATCCAGCCCAGCCTGG - Intergenic
1109851859 13:68075804-68075826 GCTATTGGGCTGGCCCAGCCTGG - Intergenic
1110596883 13:77329180-77329202 ACTGCTGTTCAGTCCCAGACAGG + Intergenic
1112064302 13:95776050-95776072 GCAGCAGGCCAGGCACAGCCAGG - Intronic
1113197725 13:107828355-107828377 GCTTCAGGTCAGGCCCTGCACGG + Intronic
1113484877 13:110646441-110646463 GAGGCTGGGGAGGCCCAGCCCGG + Intronic
1113930653 13:113967262-113967284 GCTGCCTGGCAGGGCCAGCCTGG - Intergenic
1114406761 14:22464028-22464050 GCTGCTGCTGACACCCAGCCAGG - Intergenic
1114602247 14:23966314-23966336 GGTCTTGGTCAGGCCCAGCAAGG - Exonic
1115354814 14:32436095-32436117 GCAGATGGGCAGGCCCAGACTGG + Intronic
1115556153 14:34546517-34546539 GCTGCCGGTCACGCTCGGCCTGG + Intergenic
1115557755 14:34556564-34556586 GCTGCCGGTCACGCTCGGCCTGG - Intergenic
1116811646 14:49545329-49545351 GCTTCAGGTCAGGCCGAGGCAGG + Intergenic
1117107645 14:52414662-52414684 GCTGCTGGTGAGGCTGAGGCAGG + Intergenic
1119262464 14:73245786-73245808 GCTGCTGGGTTGGCCCAGCCTGG + Intronic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122113236 14:99515743-99515765 TCTCCTGGGCAGCCCCAGCCTGG + Intronic
1122135311 14:99629241-99629263 GCTGCTGGACAGCCACAGGCTGG + Intergenic
1122381414 14:101309711-101309733 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1122480572 14:102044648-102044670 GTTGTTGGGCAGGCCCAGCCAGG - Exonic
1122647706 14:103206279-103206301 GCTGGTGGTCAGGCCCAGTATGG + Intergenic
1122663492 14:103313137-103313159 GCTACTCGGGAGGCCCAGCCAGG + Intergenic
1122870029 14:104634282-104634304 GCTCCTGGTCAGCCCCCGGCAGG - Intergenic
1123021443 14:105399565-105399587 GCTGCTCATCACGACCAGCCTGG - Intronic
1123030830 14:105450318-105450340 GCGGGAGGTGAGGCCCAGCCCGG + Exonic
1123035117 14:105468838-105468860 GCTCCTGGTCACCCCCAGCTGGG - Intronic
1123168514 14:106349190-106349212 GGTGCTGCTCAGGACCAGCAGGG - Intergenic
1202918763 14_KI270723v1_random:11812-11834 GCTGCTGGTCATGGCTAACCTGG - Intergenic
1202925873 14_KI270724v1_random:23242-23264 GCTGCTGGTCATGGCTAACCTGG + Intergenic
1123476198 15:20593859-20593881 GCTGGGGGTCTGGCCCAGCAAGG - Intergenic
1123584158 15:21742271-21742293 GGTGCTGCTCAGGACCAGCAGGG - Intergenic
1123620808 15:22184874-22184896 GGTGCTGCTCAGGACCAGCAGGG - Intergenic
1123641814 15:22406505-22406527 GCTGGGGGTCTGGCCCAGCAAGG + Intergenic
1123831596 15:24144999-24145021 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1124645957 15:31437680-31437702 GCTGCTGGCCAGGGCGAGCCAGG + Intergenic
1125153083 15:36555805-36555827 GCTGCTGTTCAAGACCAGCCTGG - Intergenic
1125849002 15:42886197-42886219 GCTCCTCGCCAGGCCAAGCCAGG + Intronic
1126048007 15:44662554-44662576 GCTGCTGGGGAGGCTGAGCCCGG + Intronic
1126762087 15:51978473-51978495 GATGCTGGTCAGCCCCTGCTGGG - Intronic
1128205739 15:65850331-65850353 TCTGCTGCCCAGGCCCAGGCTGG + Intronic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1129082447 15:73052542-73052564 GCCGCTGCTCCAGCCCAGCCCGG - Exonic
1130284769 15:82545845-82545867 GCTGCTGACCACACCCAGCCAGG + Intronic
1131263498 15:90902572-90902594 GCAGCTGGCCAGGCCCGGCCCGG + Intronic
1132045472 15:98559704-98559726 GATGCTGGCCTGGCCCTGCCTGG - Intergenic
1132447532 15:101939171-101939193 GCTGCTGGGGAGGCCGAGGCGGG - Intergenic
1132472071 16:110457-110479 GCTGCTCCTCAGGCCCAGGCAGG + Intronic
1132514962 16:361958-361980 GCTGAAGGCCAGGCCCAGTCTGG + Intergenic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132702992 16:1229875-1229897 GCCCCTGGTGAGTCCCAGCCGGG - Exonic
1132705331 16:1240993-1241015 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132708462 16:1256356-1256378 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132716288 16:1291743-1291765 GCAGCTGGTCAGGCACGGGCAGG - Intergenic
1132807149 16:1780052-1780074 GCTGCTGTTCCGGCTCAGCCAGG - Intronic
1133031795 16:3014533-3014555 GGGGCTGGGCAGGCACAGCCAGG + Intergenic
1133033802 16:3023810-3023832 GCCCTTGGTCAGGCCCACCCTGG + Intronic
1133290679 16:4718670-4718692 GCTGGTGGGCAAGCCCTGCCTGG - Intronic
1133294787 16:4746399-4746421 GCTGCGGGCCTGGCCCAGCCTGG - Exonic
1133382000 16:5338858-5338880 GCTTGAGGTCAGGACCAGCCTGG - Intergenic
1133955008 16:10434977-10434999 ACTGCTGTTCAAGACCAGCCTGG - Intronic
1135025499 16:18996179-18996201 GCTCCTCGCCAGGCCAAGCCAGG - Intronic
1135091521 16:19521880-19521902 GCTGCTGGTGACGCGGAGCCCGG - Exonic
1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG + Intronic
1136228539 16:28874046-28874068 TCTTCTGGTCAGCCCCACCCTGG + Exonic
1136416760 16:30108777-30108799 GAAGCTGGCCAGGCCCAACCAGG - Intronic
1136590604 16:31215667-31215689 CCTTCTGGTGAGGCCCCGCCTGG - Intronic
1137381262 16:48001817-48001839 GCTGCTGGGCAGGCTCAGGAAGG + Intergenic
1138345615 16:56318323-56318345 GCCGCTGGGGGGGCCCAGCCTGG - Intronic
1139373688 16:66483841-66483863 CCTGCTGGACAGGCCAAGGCTGG + Intronic
1139408321 16:66737584-66737606 GGTGCTGGGCAAGACCAGCCTGG - Intronic
1139505299 16:67395496-67395518 GCTGCTGGCCCGGCCTGGCCAGG + Exonic
1139521503 16:67485231-67485253 GGTGCTGACCAGGCCCAGCCTGG - Intergenic
1139958531 16:70704796-70704818 GCTGCAGGTGAGGCCCAGGAGGG + Intronic
1141575185 16:84959019-84959041 GCTGCTGGGAAGGCCCTGCGAGG + Intergenic
1141686638 16:85574081-85574103 GCTGCTTGTCAGGACCAGACGGG - Intergenic
1141717728 16:85736358-85736380 GCAGCAGCTCAGGCCCACCCAGG + Intronic
1142202668 16:88768566-88768588 CCTGCTTGTCAGGGCCACCCGGG - Intronic
1142351463 16:89582706-89582728 GCTGCTGGCCAGGCCGGCCCTGG + Intronic
1143112451 17:4560053-4560075 GCTGGGGAGCAGGCCCAGCCAGG + Intronic
1143115049 17:4577354-4577376 GGGGCAGGCCAGGCCCAGCCTGG - Intergenic
1143186112 17:5011424-5011446 GAAGCTGCTCAGGCCCAGGCTGG - Intronic
1143300890 17:5909918-5909940 GCAGCCGGTGAGGCCTAGCCCGG - Intronic
1143414480 17:6735999-6736021 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
1144703757 17:17354274-17354296 CCTGCTCCTGAGGCCCAGCCTGG - Intergenic
1146445844 17:32932389-32932411 TCTGCTGGGCAGGCCAAGCATGG - Intronic
1146790608 17:35748539-35748561 GTTTCTGGTGAGGCACAGCCAGG + Intronic
1147258934 17:39197516-39197538 GCCGCCGGCCCGGCCCAGCCGGG + Exonic
1147584976 17:41648772-41648794 CCTCCTGCTCAGCCCCAGCCTGG - Intergenic
1148104631 17:45112744-45112766 CCTGGGGGTCTGGCCCAGCCCGG + Intronic
1148117079 17:45182471-45182493 ACTCCTGGTCAGGGCAAGCCGGG - Intergenic
1148641208 17:49189112-49189134 GCAGCTTGTCTGGCTCAGCCGGG + Intergenic
1148765797 17:50037581-50037603 GCAGCTTGTCTGACCCAGCCTGG + Intergenic
1148873943 17:50675600-50675622 GCAGCTGGTCAGGCCCAGGGAGG - Intronic
1149384264 17:56126136-56126158 GCTGCTGGTGATGCCCAGAGTGG + Intronic
1150071682 17:62156293-62156315 TCTGCAGTTCAGGACCAGCCTGG - Intergenic
1150913439 17:69412471-69412493 GTGGCTGTTCAGGCCCTGCCTGG + Intergenic
1151714498 17:75824419-75824441 CCTGCAGGCCTGGCCCAGCCTGG + Exonic
1152459955 17:80437331-80437353 GGTGCTGGTCAGGAACTGCCCGG - Exonic
1152480050 17:80545009-80545031 GCTGAAGGCCAGGACCAGCCAGG + Intronic
1152553286 17:81040429-81040451 GCAGCTGTACAGGCACAGCCAGG - Intronic
1152628659 17:81399832-81399854 GCTGCGCGGCGGGCCCAGCCGGG - Exonic
1152674189 17:81628988-81629010 GCTGCTGGTGAGGCTGAGGCAGG - Intronic
1154060523 18:11055792-11055814 GCTGCAGCCCAGGCCCAGCGCGG - Intronic
1154492791 18:14934169-14934191 GCTGCTGGGCTGGCTCCGCCAGG + Intergenic
1156376372 18:36518850-36518872 GATGGAGGTCAGACCCAGCCAGG - Intronic
1157665962 18:49487144-49487166 GCTGCTCCGCAGGCCCAGCCCGG - Intronic
1157862591 18:51154215-51154237 GCTGCTAGACAGCCCCAGGCAGG - Intergenic
1160364102 18:78309482-78309504 CGTGCCGGGCAGGCCCAGCCCGG + Intergenic
1160507875 18:79437356-79437378 GCTGCTGGTCACTCCCTGCCTGG - Intronic
1160548520 18:79678792-79678814 GCTACTCGGCAGGCCCAGGCTGG - Intergenic
1160594417 18:79964234-79964256 GCTACTGGCCAGGCCGAGGCAGG + Intergenic
1160637740 19:93358-93380 GCTGCTGGGGAGGCCGAGGCGGG + Intergenic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1161195558 19:2984277-2984299 GCTGCTGGGCGGGCTCAGCTGGG + Intronic
1161276906 19:3423543-3423565 GCAGGTGGACAAGCCCAGCCAGG - Intronic
1161818171 19:6513024-6513046 GCTGCTGGGGAGGCCGAGGCAGG + Intergenic
1162902435 19:13803234-13803256 TCGGCAGCTCAGGCCCAGCCTGG - Intronic
1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG + Exonic
1163222370 19:15930804-15930826 GCCGCTGGTGGGGACCAGCCAGG - Intronic
1163285036 19:16341334-16341356 GCTGCTGGGGAGGCCGAGGCAGG - Intergenic
1163509658 19:17727196-17727218 GCTGGTGGCCACGCCCAGCCTGG + Exonic
1163642344 19:18468916-18468938 GTTGCTGGGCAGGCTCAGGCAGG - Intronic
1163944539 19:20523116-20523138 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1164533094 19:29062921-29062943 GCTGATGTTCTGGCCCAGCCAGG - Intergenic
1165249151 19:34515640-34515662 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
1165481570 19:36067600-36067622 GCTGATGCACAGGCCCTGCCAGG + Intronic
1166118972 19:40673601-40673623 GCTCCTGGCCCTGCCCAGCCTGG - Exonic
924977942 2:195149-195171 GTTACTGGCCAGGCCCAACCAGG + Intergenic
925334075 2:3080338-3080360 GCTGTTGGTCAGCCCCAACCTGG + Intergenic
925433938 2:3819941-3819963 GCTCCTCGCCAGGCCTAGCCAGG - Intronic
925834218 2:7928510-7928532 GCTGTTGGCCAGGGCCAGCAGGG + Intergenic
925873537 2:8292450-8292472 GCTGCTTCTCAAGCCCAGGCAGG + Intergenic
925890165 2:8427004-8427026 GCTGGTGGCCAGGCCAGGCCCGG - Intergenic
926171392 2:10555084-10555106 GCAGTGGGCCAGGCCCAGCCTGG + Intergenic
927948963 2:27154704-27154726 GCAGCTGGACAGGGCCAGGCAGG + Exonic
929044308 2:37775464-37775486 GCTGCTGGTGGGGCCCAGGTGGG - Intergenic
929076758 2:38084784-38084806 GCTCCTCGCCAGGCCCAGCTAGG - Intronic
929536440 2:42787193-42787215 GCTGCTGGCCAGGCCCCTCAGGG + Intronic
929559337 2:42945971-42945993 GCTGGTGCTCAGCCCCAGCAGGG + Intergenic
929684623 2:44023097-44023119 GCTCCTGGCCAGGCCAAGCCAGG - Intergenic
929864845 2:45709208-45709230 GGTGCTGGTCAGGAGCACCCTGG + Intronic
931152263 2:59587580-59587602 GCTACTTGTAAGGCCAAGCCTGG - Intergenic
931681333 2:64751655-64751677 GCTGCTGCTCAGACTCTGCCTGG + Intergenic
932239348 2:70144721-70144743 GCTACTGGTGAGGCCGAGGCAGG + Intergenic
932261392 2:70330627-70330649 ACTGCTGCTTAGGGCCAGCCTGG + Intergenic
932592560 2:73075977-73075999 GCTGAAGGTAAGGCCCAGCAGGG - Exonic
932896711 2:75647106-75647128 GCTGCCGGACAGGCCCCGCGTGG - Exonic
933786909 2:85850497-85850519 CCTGCTGGGCAGGCCTGGCCAGG - Intronic
933960326 2:87404285-87404307 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
934179921 2:89611328-89611350 GCTGCTGGTCATGCCCTGGAAGG - Intergenic
934244439 2:90295258-90295280 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
934264410 2:91502174-91502196 GCTACTGGGGAGGCCCAGGCAGG - Intergenic
936462094 2:112721667-112721689 GAAGCAGGTCAGGCCAAGCCAGG - Intronic
937446859 2:121965953-121965975 GCGGCTGGCCAGGCCCAGAGAGG + Intergenic
937588404 2:123584672-123584694 GGTCCAGGTCAGGCCCACCCAGG - Intergenic
937875522 2:126822752-126822774 CCCTCTGGTCAGGGCCAGCCAGG + Intergenic
938248503 2:129796640-129796662 GCAGCTGTGCAGGACCAGCCTGG + Intergenic
938518154 2:132037748-132037770 GCTGCTCCTCGAGCCCAGCCCGG + Intergenic
940216720 2:151310480-151310502 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
942150996 2:173075973-173075995 GCTGCTGCTCACGCCCCGCCCGG + Exonic
942459438 2:176159288-176159310 GCCTCTGGCCAGGCCCGGCCAGG + Intronic
943450041 2:188034886-188034908 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
943955166 2:194178750-194178772 GCTGCTGGGCAGGCTGAGGCAGG + Intergenic
944711882 2:202341921-202341943 GCTACTGGGCAGGCTGAGCCGGG + Intergenic
945255172 2:207797229-207797251 GCTGCTCTCCTGGCCCAGCCAGG + Intergenic
945803493 2:214462349-214462371 GCTTCTAGCCAGTCCCAGCCTGG + Intronic
945929144 2:215837696-215837718 GCTACTGGGGAGGCCCAGGCAGG + Intergenic
946143249 2:217709744-217709766 GCTTCTGGCAAAGCCCAGCCAGG - Intronic
946301794 2:218828399-218828421 GCTTCAGGCCAAGCCCAGCCAGG - Intronic
946307515 2:218864797-218864819 AAGGGTGGTCAGGCCCAGCCTGG - Intronic
946871850 2:224091903-224091925 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
947828777 2:233124598-233124620 GCAGCTGTTCAGGTGCAGCCAGG - Intronic
947837746 2:233187843-233187865 ACTACTGTTCAGGCCCTGCCTGG - Intronic
947870008 2:233429804-233429826 GCTGCTTCCCACGCCCAGCCCGG + Intronic
947873649 2:233453760-233453782 GCTGCTGGGAAAGCCCAGCCTGG - Intronic
948279711 2:236737795-236737817 GCTGCTGGGCACCCCCAGGCTGG + Intergenic
948455653 2:238103527-238103549 GCTGCTGGTCAATGCCAGGCGGG - Intronic
948541666 2:238695359-238695381 GCTGCTGGTCAGCCCCACAGAGG - Intergenic
948577894 2:238965882-238965904 GCTGATGGTGCGGCCCAGCTGGG + Intergenic
948830208 2:240594926-240594948 GCTGCTGCTTAGACCCTGCCAGG + Intronic
1168739259 20:174190-174212 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1169767222 20:9160064-9160086 GCTGCTGCTCAGTTCTAGCCAGG + Intronic
1170424296 20:16223337-16223359 GCTGCTGGGGAGGCTCAGGCAGG - Intergenic
1170570017 20:17627355-17627377 GCTGCTGGTCAGCCTCCGCCTGG + Exonic
1171136114 20:22696030-22696052 GCTGCTTGTAAGGCCGAGACAGG + Intergenic
1171194467 20:23186620-23186642 GCTGCTGAGCAGGCCCATCCAGG - Intergenic
1171202548 20:23254038-23254060 GGTGGTGTTCAGGCCCATCCAGG - Intergenic
1171253570 20:23668858-23668880 CCTGCTGGACAGGCCCAGAACGG + Intergenic
1171260052 20:23724152-23724174 CCTGCTGGACAGGCCCAGAATGG + Intergenic
1171269123 20:23799685-23799707 CCTGCTGGACAGGCCCAGAATGG + Intergenic
1171390095 20:24795675-24795697 GTTGGTGGTCAGGCACAGCTGGG + Intergenic
1171412918 20:24958624-24958646 GCTGCAGGGCGGGCCCAGCAGGG + Intronic
1173304215 20:41832642-41832664 GCTGCTGGTCAGGAGGAACCTGG + Intergenic
1174830250 20:53805685-53805707 GCTGCTGCTCAGGCCTGGCCTGG + Intergenic
1175072009 20:56342907-56342929 TCTGCTGGCCAGGGCCAGCCTGG + Intergenic
1175241347 20:57551744-57551766 TCTGCTGCCCAGGCCCAGCCAGG - Intergenic
1175726330 20:61320986-61321008 GCAGCTGGACAGAGCCAGCCTGG - Intronic
1175956092 20:62610147-62610169 GTTGCTGGCCAGCCACAGCCCGG - Intergenic
1176409108 21:6438160-6438182 TCTGCTCGTCCTGCCCAGCCAGG - Intergenic
1178001109 21:28162847-28162869 GCTCCTCGCCAGGCCAAGCCAGG + Intergenic
1179251670 21:39675781-39675803 GCTGCTGAGTGGGCCCAGCCAGG + Intergenic
1179571452 21:42281062-42281084 GCTGCTGGACAGGCCAGGGCAGG - Intronic
1179684601 21:43046482-43046504 TCTGCTCGTCCTGCCCAGCCAGG - Intergenic
1179896149 21:44364789-44364811 CCTGCAGGCCAGGCTCAGCCTGG - Intronic
1180181151 21:46119222-46119244 CCTGCTGGCAAGGCACAGCCAGG + Intronic
1180226704 21:46397752-46397774 GCTGCAGCACAGGCCCAGCCCGG - Intronic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1180840225 22:18955585-18955607 GGAGAGGGTCAGGCCCAGCCAGG - Intergenic
1180967587 22:19798633-19798655 GCTGGTGGGTAGGCACAGCCAGG - Intronic
1180985287 22:19900636-19900658 GCTGCTGGGGAGGCCGAGACAGG + Intronic
1180989992 22:19929972-19929994 GCAGCTGGTCACTCCCAGCATGG + Intronic
1181014773 22:20062541-20062563 GCTGCTGGGCATGCCCAGGTGGG - Intronic
1181061652 22:20284781-20284803 GGAGAGGGTCAGGCCCAGCCAGG + Intergenic
1181081452 22:20418425-20418447 GCTGCTCGGGAGGCCCAGGCAGG + Intergenic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181557196 22:23677957-23677979 GCAGCTGGACAGGCCCAGTGAGG - Intergenic
1181610135 22:24006557-24006579 GCTGGTGGCCAGGCCCTTCCTGG - Intergenic
1181697180 22:24599603-24599625 GCAGCTGGACAGGCCCAGTGAGG + Intronic
1181698609 22:24607697-24607719 GCTGCTGGGCACGCCCTGGCTGG + Intronic
1181845899 22:25708356-25708378 GCTCCTGCACAGGCCCAGCCAGG - Intronic
1182057511 22:27371326-27371348 GCAGCTGAGCAGACCCAGCCTGG + Intergenic
1182361033 22:29746625-29746647 GAGGCTGGGCAGGCCAAGCCAGG - Intronic
1183350961 22:37334659-37334681 GCCGCAGGTCCGGGCCAGCCCGG - Intergenic
1184029105 22:41880786-41880808 GCTGCAGGCCAGGTCCAGGCGGG - Exonic
1184562705 22:45272669-45272691 GCCGCTGGTCAGGCACTGCCTGG + Intergenic
1184687923 22:46104761-46104783 GCTCCTGGCCTGGCCCGGCCGGG + Intronic
1184738453 22:46412651-46412673 GCTCCTGGTCAGTCCCTCCCAGG + Intronic
1184741709 22:46432300-46432322 ACTGCTGGTGAGTCGCAGCCAGG + Intronic
1185055011 22:48575089-48575111 GCCGCTGGTCGGGCCCGGCTGGG + Intronic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
949357114 3:3192761-3192783 GGTGCTGGTCAGCTACAGCCAGG - Intergenic
950060858 3:10070328-10070350 GGTGGGGGTCAGGCCCCGCCAGG + Intronic
950141989 3:10621895-10621917 GCTTCTGCACAGGGCCAGCCCGG - Intronic
950469293 3:13174624-13174646 GCTGGTGGCCTGGCCCAGGCAGG - Intergenic
950566829 3:13774370-13774392 ACTGGTGGTCAGCCCCAGCCAGG - Intergenic
950677746 3:14564878-14564900 GGTGCTGGCCAGGCCTACCCTGG + Intergenic
952205756 3:31180721-31180743 ACAGCTGGTCAGGCCCAGAATGG + Intergenic
952917081 3:38254817-38254839 GCTGCTGCTCACTCCCAGCTAGG - Exonic
953599530 3:44349059-44349081 GCTCCTTGCCAGGCCAAGCCAGG - Intronic
953907098 3:46873886-46873908 GCAGCTGGTCTGGCCCAGTGAGG - Intronic
953950414 3:47185152-47185174 GCTGCAGTTCAAGACCAGCCTGG - Intergenic
954213332 3:49110604-49110626 CCTGCAGGTCAGGTCCAGTCAGG + Exonic
954389139 3:50259881-50259903 GCAGCTCTCCAGGCCCAGCCTGG - Intergenic
954641784 3:52104791-52104813 GCTGCTTGGGAGGCCCTGCCTGG - Intronic
957126231 3:76164853-76164875 CCTGCGGGGCAGTCCCAGCCAGG - Intronic
958158599 3:89787709-89787731 GCTGCTGCTCAGCTCCAGCCTGG + Intergenic
958977438 3:100683000-100683022 GCTGCTCATCAGGCCCTCCCTGG - Intronic
961331930 3:126147602-126147624 GCTGCTGGTGAGGCCCAGTGGGG + Intronic
961671826 3:128538037-128538059 GTTTCTGCTCAGCCCCAGCCTGG + Intergenic
961712859 3:128840594-128840616 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
961733838 3:128987907-128987929 GCTGCTGCTGAGGGCCAGGCTGG - Intronic
961782079 3:129326324-129326346 GCTGCTGGTCCGGCCTCGGCTGG - Intergenic
963111933 3:141695324-141695346 GCTCCTTGCCAGGCCGAGCCAGG - Intergenic
964176186 3:153827680-153827702 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
966853604 3:184179170-184179192 CCTTCAGGCCAGGCCCAGCCTGG - Intronic
966946582 3:184781150-184781172 GCTTATGGTCAGGGCCAGCCTGG - Intergenic
967005457 3:185378583-185378605 GCTCCTCGCCAGGCCAAGCCAGG - Intronic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
968166206 3:196467268-196467290 GCTGCTGGGGAGGCTCAGGCCGG - Intergenic
968730390 4:2266874-2266896 GAAGCTGGACAGGCCCTGCCTGG + Intergenic
969532518 4:7737665-7737687 GCTCCTGGTCATGCCCAGCAAGG + Intronic
969829362 4:9782302-9782324 GCTGCTGGTCATGCCCTGGAAGG + Exonic
974828040 4:67154169-67154191 GCTGCTGGTCAGGACCTCTCTGG - Intergenic
978438528 4:108710705-108710727 GCTCCTCGCCAGGCCGAGCCCGG + Intergenic
978503437 4:109433473-109433495 GCTGCTGCTCCGGCCCGGCCAGG - Intergenic
979678981 4:123438966-123438988 GCTGCTGGGGAGGCCGAGACAGG - Intergenic
979798384 4:124876048-124876070 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
980491440 4:133533223-133533245 GCTCCTTGCCAGGCCGAGCCAGG - Intergenic
981041416 4:140226037-140226059 GCTTCTGTCCAGGCCAAGCCTGG + Intergenic
985026225 4:185741976-185741998 GCTGCTGGTCCTGCCAAGGCTGG + Intronic
985389958 4:189483495-189483517 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
985712734 5:1439019-1439041 GCCGCTGGCCAGGGCCAGGCAGG + Intronic
985751630 5:1682002-1682024 GCTCCTTGCCAGTCCCAGCCAGG + Intergenic
985767396 5:1787219-1787241 GCTGCTGGGCAGGCTGAGGCTGG + Intergenic
985827790 5:2205436-2205458 GCTGCTGGTGAAGCCCAGCGTGG - Intergenic
989615243 5:43332010-43332032 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
992452144 5:76884790-76884812 GCTCCTCGCCAGGCCAAGCCAGG - Intronic
992471172 5:77056338-77056360 GCTGCTTGTCAGGCTGAGGCAGG - Intronic
994126197 5:96170942-96170964 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
994324734 5:98435890-98435912 GCTCCTCACCAGGCCCAGCCAGG + Intergenic
995255240 5:110038365-110038387 GCTACTGGTGAGGCCCAGTGAGG + Intergenic
996562907 5:124850182-124850204 GATTGTGCTCAGGCCCAGCCTGG + Intergenic
996900766 5:128538883-128538905 GCTGCGGGTCCGGCCAAGCCTGG - Intronic
997716899 5:136049247-136049269 GCTGGAGCTCAGGCCCAGCAAGG + Intronic
998160354 5:139809544-139809566 GCTGCTGTTCAGGCCCTCACTGG - Exonic
999428099 5:151504815-151504837 GCTGCCAGTCAGGGCCTGCCAGG - Exonic
1001396749 5:171423389-171423411 GCTGCGTGAAAGGCCCAGCCCGG - Intronic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1002471465 5:179438446-179438468 GCTCCTCCTCAGGCCCAGCCGGG - Intergenic
1002548877 5:179972400-179972422 GCTGCAGGTCAGGCCTACACAGG + Intronic
1002899162 6:1396284-1396306 GATGCTGAGCAGGGCCAGCCAGG - Intergenic
1003311700 6:4974561-4974583 GCTGCTGGTCTGGCTGAGACAGG + Intergenic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1004246857 6:13986359-13986381 GCTTCTGAGCAGGCACAGCCAGG - Intergenic
1004398188 6:15264934-15264956 GCTTCTGTTCAGACCCAGCTGGG + Intronic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006639138 6:35480020-35480042 GGTGCTGGGCAGGCCAGGCCAGG + Intronic
1007084684 6:39135067-39135089 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1007415274 6:41687948-41687970 GCTGCTGGTGACGCCCACCAGGG + Exonic
1007451266 6:41941589-41941611 GCCGCGGGTCCGGCCCGGCCCGG + Exonic
1007759834 6:44127425-44127447 CCTGCGCGCCAGGCCCAGCCCGG + Exonic
1008176331 6:48271637-48271659 GGTGCTGGTCAGGCACACCAGGG + Intergenic
1008476432 6:51939825-51939847 GCTCCTTGCCAGGCCCAGCCAGG + Intronic
1008591206 6:52995299-52995321 CCTGCTGGTCTCACCCAGCCGGG - Exonic
1008807811 6:55453288-55453310 GCTGCTGGTAAGGCTGAGGCAGG - Intronic
1009334660 6:62472271-62472293 GCTGATTGTCAGTCTCAGCCTGG + Intergenic
1012228976 6:96737791-96737813 GCTGCTGGTAAGCCCCAGCTTGG - Intergenic
1015983849 6:138866360-138866382 GCTACTTGGGAGGCCCAGCCTGG - Intronic
1018138818 6:160806471-160806493 GCTGCTTCTCAGGCCTTGCCTGG - Intergenic
1018861181 6:167712034-167712056 GCTTCTGGTGAGGCCTACCCTGG - Intergenic
1019004491 6:168784753-168784775 CCTGCAGGTCCGGCCAAGCCCGG + Intergenic
1019135924 6:169907695-169907717 CCTGCTGCCCTGGCCCAGCCTGG - Intergenic
1019302962 7:318181-318203 GCCCCAGGCCAGGCCCAGCCAGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019553129 7:1613648-1613670 GCTGCTAGGGAGGCCCAGGCAGG + Intergenic
1019641886 7:2107657-2107679 CCTCCTGGTAAGGCCCTGCCTGG + Intronic
1020222257 7:6248633-6248655 GCTGCTGCACAAGCCCACCCCGG + Intronic
1020794116 7:12661237-12661259 GCTCCTGGCCAGGCTGAGCCAGG + Intergenic
1021254641 7:18375774-18375796 GCAGCTGGTTAGGGCCAGCTAGG - Intronic
1021828060 7:24573788-24573810 GCTGCTGGCCGCCCCCAGCCCGG + Intronic
1022103046 7:27180500-27180522 TCTGCTGCTCTGGCCCTGCCTGG + Intergenic
1022385617 7:29896195-29896217 GCTGCTGGGGAGGCTCAGGCAGG + Intronic
1023185503 7:37528914-37528936 GCTCTTTGTCAGGCCCTGCCTGG + Intergenic
1023837060 7:44074431-44074453 GCTGTGGGGCAGGCCCTGCCTGG - Exonic
1023875955 7:44286520-44286542 GCTGCTGGCCAGACTCAGACAGG + Intronic
1024325220 7:48104104-48104126 GCTGCTGGTGAGGCTGAGGCAGG + Intronic
1024726881 7:52207929-52207951 GCTGCTGGGGAGGCTCAGGCAGG + Intergenic
1025878275 7:65508738-65508760 GCCGCTGCTCGAGCCCAGCCCGG + Intergenic
1025997810 7:66539170-66539192 ACTGCTGGTTAGCCGCAGCCTGG + Intergenic
1026278366 7:68900195-68900217 GCTGCTGGTTAGAGCCAGCATGG - Intergenic
1026925103 7:74186323-74186345 GCTGCTGGGCAGGCTGAGGCAGG - Intronic
1027785990 7:82579645-82579667 GCTACAACTCAGGCCCAGCCTGG + Intergenic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029456173 7:100673689-100673711 GCAGTTGGTCTCGCCCAGCCGGG + Exonic
1029457195 7:100677352-100677374 GCTGCTGGTCAGCGCCTCCCAGG + Exonic
1029552517 7:101244944-101244966 CCTGCTGGTGAGGCCTGGCCCGG - Exonic
1030163707 7:106532469-106532491 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
1032121513 7:129160410-129160432 GCTGCTGCTTAGCACCAGCCTGG + Intronic
1032410372 7:131689877-131689899 TCTGCGGGTCAGGCTCAGGCTGG + Intergenic
1032478259 7:132226926-132226948 GGTGAGGGACAGGCCCAGCCTGG - Intronic
1032536820 7:132671431-132671453 CCTCCTGGTCAGTCCCACCCAGG - Intronic
1032591332 7:133194467-133194489 GCAGCGGGGGAGGCCCAGCCAGG - Intergenic
1032847193 7:135761825-135761847 GCCTCTGTTCAGGCCCAGGCAGG + Intergenic
1033084621 7:138330673-138330695 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1033625492 7:143106493-143106515 GCTCCTTGCCAGGCCAAGCCAGG + Intergenic
1034218131 7:149423125-149423147 GCTGGTGTTCATACCCAGCCAGG + Intergenic
1034347806 7:150397789-150397811 GCGGCTCGCCAGGCCCAGCGAGG - Exonic
1034438535 7:151075218-151075240 GGTGCTGCTGAGGCCCAGGCTGG - Intronic
1034964374 7:155382487-155382509 GCTGCAGGACGGGGCCAGCCAGG - Intronic
1035024542 7:155817250-155817272 GCTCCATGCCAGGCCCAGCCGGG - Intergenic
1035370810 7:158377800-158377822 GCTGCTGGTACGGCCCTGCACGG + Intronic
1035744632 8:1952751-1952773 GCTGATGGTCGGCACCAGCCTGG + Exonic
1036173226 8:6510510-6510532 CCTGCTGGTCGGGCCAGGCCAGG + Intronic
1036645739 8:10610801-10610823 GCTGCTGGGCCGGCCCTGCTTGG + Exonic
1036802655 8:11803659-11803681 TCTTCTGGTCTGGACCAGCCTGG + Intronic
1037335639 8:17789142-17789164 GCTACTGGTCAGGCTGAGGCAGG - Intronic
1037566608 8:20123369-20123391 GTTGCTGGGCAGGCATAGCCAGG + Intergenic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037974530 8:23200236-23200258 TCCACTGGTCAGGCCCATCCAGG - Intronic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1039401675 8:37275179-37275201 GCTGCTGGGCAGAGCCAGGCAGG + Intergenic
1039804935 8:40989731-40989753 GCTGCTGGTCAGGGCGGCCCAGG - Intergenic
1041274278 8:56141921-56141943 GCAGCAGGGCAGGCCCAGCTAGG + Intergenic
1041510530 8:58650213-58650235 GCTGCTGCCTAGGCCTAGCCTGG - Intronic
1042250887 8:66755145-66755167 GCTGCTGGGCAGGCTGAGGCAGG + Intronic
1042707279 8:71676590-71676612 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1043597545 8:81902574-81902596 GCTCCTCATCAGGTCCAGCCAGG - Intergenic
1043861782 8:85326027-85326049 CCAGCTGGTGAGGCCCAGCGTGG - Intergenic
1048402813 8:134087726-134087748 GCTCCTGGTCAGCCCCATCTGGG - Intergenic
1048898934 8:139019834-139019856 GCAGGTGGTCAGCCCCAGCAGGG - Intergenic
1049538403 8:143193768-143193790 GCTGCTGGGCAGGGCCACACGGG - Intergenic
1049799987 8:144513250-144513272 GCTGCCCGTCACGCCCGGCCCGG + Exonic
1049839542 8:144762349-144762371 GCAGCTGGCCACACCCAGCCAGG - Intergenic
1050474073 9:6021627-6021649 GCTCCTAGCCAGGCCAAGCCAGG + Intergenic
1053022096 9:34701785-34701807 TCTGCGGGGCCGGCCCAGCCCGG + Intergenic
1053429071 9:38030093-38030115 GCTGCTGGTCATGCCCTCACTGG - Intronic
1055095883 9:72413914-72413936 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1055621061 9:78125692-78125714 GCTGCTGGTCTGGCGCCACCCGG - Intergenic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1056363612 9:85882333-85882355 GCTCCTCGACAGGCCAAGCCAGG + Intergenic
1056558115 9:87706626-87706648 GCTGCTGGTCAACCACGGCCAGG + Exonic
1057812669 9:98269878-98269900 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1059863573 9:118489706-118489728 GCTCCTCGTCAGGCCGAGCTAGG - Intergenic
1060052014 9:120384407-120384429 GCTCCTGGTGAGGCCCAGAGGGG - Intergenic
1060666514 9:125435290-125435312 GTTCCTGGCCAGGCCCTGCCAGG - Intergenic
1061019709 9:128006202-128006224 CCGGCTGGACAGGACCAGCCAGG + Intergenic
1061092765 9:128435841-128435863 GCTGCCAGTCAGGTCCAGGCGGG - Exonic
1061194518 9:129100495-129100517 GCTGCAGGTGAGGCCCGGCAGGG - Exonic
1061811788 9:133166617-133166639 GCAGCAGCTCAGGGCCAGCCTGG + Intergenic
1061838452 9:133344061-133344083 CCTGCTGGCCAGGCCCAGGTAGG + Intronic
1061900844 9:133671229-133671251 CCTGGGGGTCAGGCCCAGGCTGG - Intronic
1062077690 9:134600815-134600837 TCTGCTGGCCAGGCCAGGCCAGG + Intergenic
1062208092 9:135348292-135348314 GGGGCTGGTGAGGACCAGCCGGG - Intergenic
1062269935 9:135703745-135703767 GGAGCAGGTCAGGCCCAGCAGGG - Intronic
1062380319 9:136283936-136283958 CCTGCTGCCCAGGCCCAGTCCGG - Intronic
1062532013 9:137006190-137006212 GCGGCTGTCCAGGTCCAGCCTGG + Intergenic
1062561062 9:137142104-137142126 GCGGGTGGTCAGCCCCAGCACGG - Exonic
1062628367 9:137453040-137453062 GGTCATGGTGAGGCCCAGCCCGG - Exonic
1188333115 X:28896656-28896678 GCTCCTCGCCAGGCCGAGCCAGG - Intronic
1189757089 X:44282940-44282962 GCTGCTGGCCTGACCCAGGCTGG + Intronic
1190017800 X:46843117-46843139 GCTGCTGGGGAGGCCGAGACAGG - Intronic
1190740427 X:53284847-53284869 GCTGTTGGCCAGGCCGACCCAGG + Intronic
1191014288 X:55792343-55792365 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
1192454498 X:71265850-71265872 GCTCCTTGCCAGGCCGAGCCAGG + Intergenic
1192809590 X:74536760-74536782 GATCCTCGACAGGCCCAGCCCGG - Intergenic
1192914227 X:75636329-75636351 GCTCCTTGCCAGGCCAAGCCAGG - Intergenic
1195239499 X:102937280-102937302 CTTGCTGGTCTGGCCCAGGCGGG + Exonic
1195291250 X:103433596-103433618 GCTCCTCGCCAGGCCAAGCCAGG - Intergenic
1196496775 X:116332465-116332487 GCTCCTCGCCAGGCCGAGCCAGG + Intergenic
1196778560 X:119362222-119362244 GATGGGGGTCAGCCCCAGCCAGG + Intergenic
1199377710 X:147133166-147133188 GCTCCTCGCCAGGCCGAGCCAGG - Intergenic
1200058836 X:153475052-153475074 GCTGGAGCTCAGGCCCGGCCGGG - Intronic
1200070645 X:153527372-153527394 GCTGCTGGGCAGGCCCGGGCTGG + Intronic
1201439205 Y:13990194-13990216 TCTGTTGTTCAGGCCCAGGCTGG + Intergenic
1201439447 Y:13992533-13992555 ACTGTTGTTCAGGCCCAGGCTGG + Intergenic
1201445126 Y:14050175-14050197 ACTGTTGTTCAGGCCCAGGCTGG - Intergenic
1201445368 Y:14052514-14052536 TCTGTTGTTCAGGCCCAGGCTGG - Intergenic