ID: 1038613261

View in Genome Browser
Species Human (GRCh38)
Location 8:29072147-29072169
Sequence GCTTCACTCAGGGGGCTGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038613247_1038613261 24 Left 1038613247 8:29072100-29072122 CCGACAGGGTCGCGGTGGAGACG 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1038613261 8:29072147-29072169 GCTTCACTCAGGGGGCTGGGGGG 0: 1
1: 0
2: 3
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038613261 Original CRISPR GCTTCACTCAGGGGGCTGGG GGG Exonic