ID: 1038614055

View in Genome Browser
Species Human (GRCh38)
Location 8:29076601-29076623
Sequence TGGTGAGCACCCTGCTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038614055_1038614059 14 Left 1038614055 8:29076601-29076623 CCCGCTCAGCAGGGTGCTCACCA 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1038614059 8:29076638-29076660 GAATAGCCTCGCTTCACCTGAGG No data
1038614055_1038614057 -8 Left 1038614055 8:29076601-29076623 CCCGCTCAGCAGGGTGCTCACCA 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1038614057 8:29076616-29076638 GCTCACCATGTTTACAAGCATGG No data
1038614055_1038614060 15 Left 1038614055 8:29076601-29076623 CCCGCTCAGCAGGGTGCTCACCA 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1038614060 8:29076639-29076661 AATAGCCTCGCTTCACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038614055 Original CRISPR TGGTGAGCACCCTGCTGAGC GGG (reversed) Intronic
900396459 1:2455092-2455114 TGCTGAGCCCCCAGCGGAGCCGG + Intronic
900802900 1:4748281-4748303 GCGTGATCACCCTGCTGTGCTGG + Intronic
900832293 1:4973811-4973833 GGGTCAGCACCCTGTGGAGCAGG - Intergenic
901814894 1:11788365-11788387 TGGTGCGGACCCTGGTGAGTGGG + Exonic
902248685 1:15139078-15139100 TGGTCAGCAACCAGCAGAGCTGG + Intergenic
902271603 1:15309005-15309027 TGGTGAGGTCCATGCTCAGCAGG - Intronic
902787845 1:18744872-18744894 CGGGGAGCACTCTGCTGTGCTGG + Intronic
904078364 1:27856719-27856741 TGGTGGGCCACCTGCTGAGAAGG + Intergenic
904439432 1:30520705-30520727 TACTAAGCACCCTGCTGTGCTGG - Intergenic
905262999 1:36732320-36732342 TGGTGGGCACCCTCCTCACCAGG + Intergenic
905397276 1:37674799-37674821 GGCTGAGCCCCTTGCTGAGCTGG + Intergenic
906346564 1:45019282-45019304 TGGTGAGCATCTTGCAGAGCTGG - Exonic
912256074 1:108059303-108059325 TGGTGAACACGTTGATGAGCCGG + Intergenic
912554803 1:110508279-110508301 TGGTGAGGGGCCTGCTGAGGTGG + Intergenic
912582144 1:110730319-110730341 TGGGGAGCACACAGGTGAGCGGG - Intergenic
912706548 1:111919319-111919341 TGGTGGGCACACAGCTGAGGTGG + Intronic
915289071 1:154870619-154870641 AGGTGTGCACCCTGATGAGGGGG + Intergenic
915740188 1:158113423-158113445 TGCCGAGCCCCCTGCCGAGCGGG - Intergenic
916187280 1:162145587-162145609 AGCTGAGCGTCCTGCTGAGCGGG - Intronic
916582359 1:166120417-166120439 TGCTGGGCACCCTGCTAAGTAGG - Intronic
919766849 1:201132946-201132968 GGGTGAGCACACTGCTTGGCTGG - Intergenic
920370658 1:205477449-205477471 TGAGGAGCACACTGGTGAGCAGG + Intergenic
920374946 1:205503263-205503285 TGGTGAGAAGCCTGGGGAGCAGG - Intergenic
921045775 1:211476996-211477018 TGGTAAGCAGACTGCTCAGCTGG - Exonic
921159151 1:212460829-212460851 TGATGAGCACCCCGCTGGGGAGG - Intergenic
922807173 1:228396368-228396390 TGGTGAGCACACTGAGGTGCTGG + Intronic
1063131947 10:3185791-3185813 TGGGGAGCACACAGGTGAGCAGG - Intergenic
1063946587 10:11182127-11182149 AGGTGAGCACGCTGCTCAGAGGG - Intronic
1064009974 10:11727854-11727876 TGGTGAGGCCCCTGTTGAGGGGG + Intergenic
1064452060 10:15451502-15451524 TCCTGAGCTCCCTGCTGTGCAGG + Intergenic
1064998053 10:21313792-21313814 AGGTGAGCCCCCAGCTGTGCTGG + Intergenic
1067432009 10:46251218-46251240 TGGCGAGCACCCAGCTGGGAGGG - Intergenic
1070891221 10:79943379-79943401 TTATGAACCCCCTGCTGAGCAGG - Intronic
1073218626 10:101851435-101851457 TGGAGAGCTCCCTGCTCAGTAGG + Intronic
1074203296 10:111258653-111258675 TGGTGAGAGGCCAGCTGAGCAGG - Intergenic
1075082263 10:119391797-119391819 TGGTGAGCATTGTGCTGACCAGG + Intronic
1075777660 10:124998764-124998786 TGCTCAGCACCCTGCTCTGCTGG + Intronic
1076393385 10:130120522-130120544 TGATGAGCACCCTGGAGAACTGG - Intergenic
1076846804 10:133073196-133073218 TGGTGAGGACCCTGGGCAGCAGG + Intronic
1076903676 10:133351931-133351953 TGGTGGGCACCCTCCTGCGGGGG + Intronic
1078930732 11:15910547-15910569 TGGCCAGCAGCCTGCGGAGCTGG + Intergenic
1079000932 11:16755011-16755033 TGCTGAGCACCCTGATGAAGTGG + Exonic
1079013406 11:16848038-16848060 TGGGGAGCACACTGTAGAGCAGG - Intronic
1080427043 11:32164982-32165004 TGGTGAGCACACTGTTGCGAAGG - Intergenic
1083883894 11:65561385-65561407 TCCTGACCTCCCTGCTGAGCTGG - Intergenic
1085250753 11:75142114-75142136 TGGTGAGCTCTCTGCTGAGCCGG + Intronic
1089286213 11:117409688-117409710 TGCTGAGGACACTGCTCAGCTGG - Exonic
1090076415 11:123582513-123582535 TGGAGAGCACCTTGCAGAGGGGG + Intronic
1096123349 12:49102832-49102854 GGGTGAGCTTCCTGCAGAGCTGG - Intronic
1097049961 12:56216764-56216786 TGGTGAGCTCCCTCCTTAGAAGG - Intronic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1102022279 12:109692019-109692041 TGGTGAGCACACTGATGTGCTGG + Intergenic
1103304891 12:119956206-119956228 TGGTGAGTAACCTGCTGTGCAGG - Intergenic
1103499599 12:121391014-121391036 TGGTGAGCATCATGCTGGACTGG + Intronic
1103813410 12:123633871-123633893 CGGTGAGGACCCTGCAGGGCGGG + Exonic
1110593729 13:77294859-77294881 GGGTGAGCACCCTGGTGAATAGG - Intronic
1113806854 13:113115066-113115088 TGGTGTGCATCCTGCAGGGCAGG + Intronic
1113914180 13:113861170-113861192 AGGTGAGCACACTGGAGAGCTGG + Intronic
1116370133 14:44120281-44120303 TGCTGAGCACCCTGATGAAGTGG - Intergenic
1118736149 14:68703131-68703153 TGGGGAGCTCCCTGCAGGGCTGG + Intronic
1119921757 14:78453095-78453117 TGGTGACCACCCTCCTCATCTGG - Intronic
1120343663 14:83255385-83255407 TGGTGAACACACTGATGTGCTGG - Intergenic
1120671708 14:87369798-87369820 AGGTGAGCACGCAGCTGGGCTGG + Intergenic
1121262028 14:92573371-92573393 TGGTGAACACACTGATGTGCTGG - Intronic
1122268915 14:100559583-100559605 TGGTGAGCAGCCTGGTGGGGTGG - Intronic
1122630818 14:103107044-103107066 AGGTGAGGTCCCAGCTGAGCAGG + Intronic
1123019891 14:105392757-105392779 TGCTGGGCAGCCTGCTGACCTGG - Exonic
1124355433 15:28991720-28991742 TGCTGAGCACCATGGTCAGCAGG - Intronic
1127977129 15:64006092-64006114 TAGGGAGAACCATGCTGAGCTGG - Intronic
1129198658 15:73985706-73985728 TGGTGAGCCCCCAGCAGAGGAGG + Intronic
1131098612 15:89671353-89671375 TGGTGAGCACCCTCCAAGGCTGG - Intronic
1132784252 16:1646024-1646046 TGGTGTGCAGCCTTCTGAGATGG + Intronic
1134019269 16:10910215-10910237 TGGGGAGCTCCCTGCTGTTCGGG + Exonic
1135111739 16:19695679-19695701 TGGTGTGCACCCTGAGTAGCTGG + Intronic
1135283152 16:21170547-21170569 TGGTAAGCACCACGATGAGCAGG - Exonic
1135568319 16:23529252-23529274 TGGTGAGTACACGGCAGAGCTGG + Intronic
1136080058 16:27846322-27846344 GGGTCAACACCCTTCTGAGCAGG - Intronic
1137508092 16:49074039-49074061 TGTTGCCCAACCTGCTGAGCTGG - Intergenic
1137587135 16:49670390-49670412 TTGGGACCAGCCTGCTGAGCTGG - Intronic
1138456728 16:57125309-57125331 CGGTGAGCTCCCAGCTGATCGGG + Intronic
1140126573 16:72123344-72123366 TGGAAAGCCCTCTGCTGAGCTGG - Intronic
1140250394 16:73289748-73289770 TGGTGAGCCCCCAGGGGAGCAGG + Intergenic
1141632897 16:85298363-85298385 TGGTGATAGCCCTGCTCAGCGGG - Intergenic
1142149251 16:88505516-88505538 TGGTGAGCACTCTGGGGACCTGG + Intronic
1144629930 17:16865922-16865944 TGGCCAACCCCCTGCTGAGCTGG + Intergenic
1144651500 17:17010195-17010217 TGGCCAACCCCCTGCTGAGCTGG - Intergenic
1144895881 17:18531983-18532005 AGGTCAGTACCCTGCTGGGCTGG + Intergenic
1144948493 17:18981804-18981826 TGGCCAGCTTCCTGCTGAGCTGG - Intronic
1146309915 17:31759855-31759877 GGGTTAGCTGCCTGCTGAGCTGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147164893 17:38587780-38587802 TGGTGAGCATCCCCCTGGGCTGG - Intronic
1147836689 17:43337894-43337916 TGATCAGCCACCTGCTGAGCAGG + Intergenic
1148109487 17:45136619-45136641 TGGTGAGCTCCCTGCTGGCTGGG + Exonic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149865341 17:60148417-60148439 TGGCCAGCCCCCTGATGAGCAGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150281522 17:63931961-63931983 TGGAGAGCATCAGGCTGAGCTGG - Intronic
1151439188 17:74117208-74117230 TGGTGTGAGCACTGCTGAGCTGG + Intergenic
1152137309 17:78512093-78512115 AGGTGGGCACCCTCCTGGGCTGG + Intronic
1152409840 17:80117781-80117803 TGGACAGCACACTGCAGAGCTGG + Intergenic
1152469956 17:80485562-80485584 TGGTGGGCACCCTCTGGAGCAGG + Intergenic
1153631127 18:7070998-7071020 GGGAGAGGACCCTACTGAGCAGG + Intronic
1153926853 18:9842145-9842167 TGCTGAGCACACTGGTGTGCTGG - Intronic
1154215360 18:12411821-12411843 TGGTGGGCATCCTTCTGAGGGGG + Intronic
1156309048 18:35905972-35905994 TGGGGAGTACCCTGGTCAGCTGG - Intergenic
1160551420 18:79696057-79696079 TGGTGAGCTCCGAGGTGAGCCGG + Exonic
1160930211 19:1566843-1566865 TGGGGTGCAGCCTGCTGGGCAGG - Intronic
1160981211 19:1817448-1817470 TGGTTGGGACCCTGGTGAGCAGG + Intronic
1161000333 19:1907622-1907644 TGGTGACAACCCTGGTGAACAGG - Intronic
1161265656 19:3362774-3362796 TTGTGAGCCCCTTGCTGAGCAGG + Intronic
1161453259 19:4358171-4358193 TGGTGAGCTCGCTGCGGGGCGGG + Intronic
1162554966 19:11381156-11381178 TGCTGAGCAACCTGCGGGGCCGG - Exonic
1163591924 19:18198704-18198726 TGGTGAGTGCCCAGCTGGGCTGG - Exonic
1164512871 19:28911835-28911857 TGGTGTGTACCCTGGTGGGCTGG - Intergenic
1166312242 19:41969483-41969505 TGGTGGGCATCCGGCTGAACTGG - Exonic
1166830890 19:45639153-45639175 TGGGGAGCACCTTGCTGATTAGG - Intronic
925134423 2:1516358-1516380 TGGACAGCACCTTGCAGAGCTGG - Intronic
925962399 2:9030004-9030026 TAGTGGGCACCCAGCTGTGCCGG + Intergenic
926758248 2:16253058-16253080 TGGTGAGCACCCTGGGGTGGAGG - Intergenic
928071656 2:28223302-28223324 TGGGGAGCACACTGCAGAGGGGG + Intronic
931758490 2:65395372-65395394 TGGTGAGAACCCTGGAGAGAAGG - Intronic
932398401 2:71463503-71463525 TGTTGTGCACTCTGCAGAGCCGG - Intronic
932606088 2:73166549-73166571 TAGTGAGCTACCTGGTGAGCTGG - Intergenic
932837334 2:75049764-75049786 TGGTGGGCAGCCCTCTGAGCAGG - Intronic
933926339 2:87093902-87093924 TAGTGAGCTACCTGGTGAGCTGG + Intergenic
934898298 2:98138063-98138085 TGGGGAGGGGCCTGCTGAGCAGG - Intronic
935749254 2:106215907-106215929 TGGTGAACACCTTGCTGATCAGG + Intergenic
935756718 2:106282159-106282181 TGGTGAGCACCGCTCTCAGCAGG + Intergenic
936112844 2:109678866-109678888 TGGTGAGCACCGCTCTCAGCAGG - Intergenic
936122049 2:109755452-109755474 TGGTGAACACTTTGCTGACCAGG - Intergenic
936222645 2:110616022-110616044 TGGTGAACACTTTGCTGACCAGG + Intergenic
939745523 2:145961508-145961530 TGGGTAGCGTCCTGCTGAGCTGG + Intergenic
947162514 2:227228480-227228502 TGGTTAACACCCTACTGAGCAGG - Intronic
947765307 2:232633865-232633887 AGCTGAGCGCCCAGCTGAGCCGG + Exonic
1169197638 20:3692101-3692123 CAGTGAGCCACCTGCTGAGCTGG - Exonic
1169832234 20:9838118-9838140 TTGTGGGCACCCTTGTGAGCAGG - Intronic
1171298509 20:24039498-24039520 TGGTGAGGGCCCTGCAGGGCGGG + Intergenic
1172169003 20:32917580-32917602 TGGGGAGCACCCTGGGAAGCAGG + Intronic
1173288183 20:41691607-41691629 TGGTCATAACCCTGCTGATCAGG + Intergenic
1173518502 20:43682216-43682238 TGGTGAGGCCCCTGCAGGGCTGG + Intronic
1173579467 20:44137077-44137099 TGCTGGGCACAATGCTGAGCTGG - Intronic
1175886973 20:62297636-62297658 TGGTGAGCTTCCCACTGAGCTGG + Intergenic
1176111754 20:63414067-63414089 TGGTGAGGCCCCTGCCCAGCCGG - Exonic
1176227533 20:64010116-64010138 TGGTGAGCATGCTGCTGGTCAGG - Intronic
1176282863 20:64324848-64324870 TGGGGAGCTCCCTGCAGAACTGG - Intergenic
1179136386 21:38683636-38683658 TGCTGAGGACTCTGCTGTGCAGG - Intergenic
1180060207 21:45381194-45381216 TGCTGGGAACCCTGCTGAGATGG - Intergenic
1180921142 22:19522307-19522329 TTGTGAGCACCATTCTGGGCAGG + Intergenic
1181580590 22:23825917-23825939 TGATGAGTACCATGCTGGGCTGG + Intronic
1183192802 22:36332490-36332512 TGGTGTGGATGCTGCTGAGCAGG - Intronic
1183741868 22:39673204-39673226 TGGTGGGCTCCTTGCTGAACAGG + Intronic
1185310787 22:50153148-50153170 TGGTGACCTCCTTGCTGGGCTGG + Exonic
950950624 3:16994805-16994827 TGGTGAGCACTGTGGAGAGCAGG - Intronic
952387206 3:32850711-32850733 TGGAGAGAACGCTGCTAAGCAGG + Intronic
954436744 3:50500331-50500353 GGTGGAGCACCCGGCTGAGCTGG - Intronic
955022130 3:55131767-55131789 TGGGGCGCACCCAGCTGAGGAGG - Intergenic
955071812 3:55577983-55578005 TGGTGAGCTCCCTGCAGTGGGGG - Intronic
958024002 3:88028751-88028773 TGGGGAGCACACAGATGAGCAGG - Intergenic
958542510 3:95497288-95497310 TGGTGAACAGCATGCAGAGCAGG + Intergenic
960374846 3:116887376-116887398 TGCTGAGCACTCTTATGAGCAGG + Intronic
960535726 3:118812701-118812723 AGGTAAGCACCCTGCTGTGTAGG + Intergenic
961430005 3:126874801-126874823 TGGGGACCATCCTTCTGAGCAGG - Intronic
961430107 3:126875293-126875315 TGGCCAGCACCCTGCTGGACAGG - Intronic
961604911 3:128086389-128086411 TGTTGAGCATCGTGTTGAGCAGG - Intronic
962343109 3:134601752-134601774 TGATGGGCACCCTTGTGAGCTGG + Intronic
964776704 3:160287130-160287152 TAGTGAACACACTGATGAGCTGG + Intronic
967894473 3:194384983-194385005 TGGTCAGCACCCTCCAGGGCCGG - Intergenic
968350341 3:198047600-198047622 TGCTGAGATCCCTGCTGACCAGG + Intergenic
968894166 4:3388935-3388957 TGGGGAGCAATCTGCTCAGCTGG + Intronic
969116433 4:4873214-4873236 TGCTGAGGCCCCTGCTGTGCTGG + Intergenic
970884652 4:20974067-20974089 TTGTGGCAACCCTGCTGAGCAGG - Intronic
978527758 4:109682592-109682614 TAATGAGCACACTGCTGAGATGG + Exonic
982261071 4:153494891-153494913 GGGTGAACACCCGGCAGAGCAGG - Intronic
1202762263 4_GL000008v2_random:122567-122589 TGCTGAGATCCCTGCTGACCAGG + Intergenic
985579245 5:688416-688438 TGGTGGGCACACTGCTGTGCTGG - Intronic
985594088 5:780479-780501 TGGTGGGCACACTGCTGTGCTGG - Intergenic
986814996 5:11399114-11399136 TGGTGACCACCCAGCTGAAAAGG - Intronic
988966669 5:36425586-36425608 TGGTGAGCACACTGAGGTGCTGG - Intergenic
994017909 5:94989867-94989889 TGGTGAACACACTGATGTGCTGG + Intronic
997387847 5:133487727-133487749 TGGTCAGCACCATCCTGAGATGG - Intronic
1000632991 5:163612374-163612396 TGGTGAGCAAGCTGATGAGTGGG - Intergenic
1002461793 5:179377567-179377589 TGGTGAGCAGCGTGCGGAGGAGG + Intergenic
1002864414 6:1108256-1108278 TGGTGAACACCCTGGAGATCAGG + Intergenic
1002868865 6:1147758-1147780 TGGGGAGCACCGTGGTGAGCAGG - Intergenic
1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG + Intergenic
1003280925 6:4690664-4690686 CGGTGGGCACCCTGCTTGGCAGG - Intergenic
1004080080 6:12383528-12383550 TGGTGAGCAGCCTGAGGAGAAGG - Intergenic
1005363326 6:25053341-25053363 TGGGGAGCACACAGGTGAGCAGG + Intergenic
1006428181 6:33979023-33979045 TGGTGCTCACCCTGCTGAGGAGG - Intergenic
1011233868 6:85193422-85193444 TGGGGAGCACACAGGTGAGCAGG - Intergenic
1014645608 6:123968896-123968918 TGTGGAGCACCTTGCTGTGCTGG + Intronic
1017575580 6:155798720-155798742 GGGTGATAACCATGCTGAGCTGG + Intergenic
1021083002 7:16385853-16385875 TGGGGAGCACCCAGATGGGCAGG + Intronic
1023375607 7:39552352-39552374 TGGTGAGCACACAGGTGTGCTGG + Intergenic
1023867368 7:44244538-44244560 TGGTGAGTACCCCGCTGTCCTGG + Intronic
1025908464 7:65808450-65808472 TGCTGAGCACCGTGCAGGGCAGG - Intergenic
1027967370 7:85029190-85029212 TGATGAGCACCATGGTGTGCAGG - Intronic
1028910327 7:96200817-96200839 TGTTGAGCAGCCTGTTGTGCAGG - Intronic
1033224298 7:139548472-139548494 AGGTGAGCTGCCTGCTGTGCTGG + Intergenic
1033830483 7:145245656-145245678 TGGTTAGCTGGCTGCTGAGCTGG - Intergenic
1034979052 7:155464373-155464395 GGGTGTGCACACGGCTGAGCTGG + Exonic
1035087989 7:156277856-156277878 TGTTGATCTGCCTGCTGAGCTGG + Intergenic
1035422868 7:158743612-158743634 TGGTGAGCAGCTGGCTGAGGGGG + Exonic
1035857838 8:2995790-2995812 TGGTGTGCAGCCTTCTGAGATGG - Intronic
1036700625 8:11011420-11011442 AGGTGAGCACCAGGCTGAGGAGG + Intronic
1038406137 8:27324376-27324398 TTGTGAGCCCCATGCTGGGCAGG + Intronic
1038440709 8:27569216-27569238 TGGCCAGGACCCTTCTGAGCAGG + Intergenic
1038614055 8:29076601-29076623 TGGTGAGCACCCTGCTGAGCGGG - Intronic
1040897874 8:52388223-52388245 AGATGTGCACCCGGCTGAGCAGG + Intronic
1043356931 8:79424784-79424806 TGGTAATCACCAGGCTGAGCTGG - Intergenic
1044993613 8:97818223-97818245 TGGTGTTCACCCTGGTGAGCAGG + Intronic
1048445018 8:134486756-134486778 TAGTGAGCACCACGATGAGCAGG + Intronic
1048526767 8:135210017-135210039 TGCTGAACACCATGCTGGGCAGG - Intergenic
1048950790 8:139495334-139495356 GGCTGTGCACCTTGCTGAGCAGG - Intergenic
1049748984 8:144274704-144274726 TGGGCAGCCCCCTGCTGTGCTGG - Intronic
1049880466 8:145058634-145058656 GGGTCAGCCGCCTGCTGAGCAGG - Intergenic
1050102052 9:2129521-2129543 TAGTGAACACACTGATGAGCTGG - Intronic
1050388665 9:5114184-5114206 GGGTGAGCACCTACCTGAGCCGG + Intronic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1052996378 9:34553592-34553614 TGGTTATCACCCTGCTGGGGCGG + Intronic
1053111507 9:35464411-35464433 TGATGAGCCCACCGCTGAGCTGG + Intergenic
1055149425 9:72977874-72977896 TTGTGGGCACCCAGCTTAGCTGG + Intronic
1056328947 9:85505791-85505813 TGTAGAGCACCGTGCTGAGTTGG + Intergenic
1056934263 9:90903774-90903796 GGGTCAGCCTCCTGCTGAGCAGG - Intergenic
1057179223 9:93020903-93020925 TGGTCAGCGCCCAGCTGGGCGGG + Intronic
1058176014 9:101737665-101737687 TGGGGAGCACCCTGCATGGCCGG - Exonic
1059509478 9:114830657-114830679 AGGAAAGCACCCTGCAGAGCTGG + Intergenic
1059554711 9:115268022-115268044 TGTTTAGCACCCAGCTGAGGGGG + Intronic
1061573791 9:131493773-131493795 TGGTGAGTACCCTCCCCAGCAGG - Intronic
1062363926 9:136199996-136200018 TGGCGACCACCCTGCAGGGCCGG - Intronic
1062475197 9:136723238-136723260 TGGAGAGCACCCTGCAGGGCAGG - Exonic
1203543027 Un_KI270743v1:107448-107470 TGCTGAGATCCCTGCTGACCAGG + Intergenic
1189480650 X:41389944-41389966 TGGTGAGTTCACTGATGAGCAGG + Intergenic
1195294699 X:103464525-103464547 TGGTGAACACCCTGCTCTCCAGG - Intergenic
1201738992 Y:17303662-17303684 GAGTGAGCATGCTGCTGAGCTGG + Intergenic