ID: 1038621492

View in Genome Browser
Species Human (GRCh38)
Location 8:29147504-29147526
Sequence GCTTATGTATGAGCACGAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038621492 Original CRISPR GCTTATGTATGAGCACGAAT TGG (reversed) Exonic
905435203 1:37951075-37951097 GCTTGTGGATGAGTAGGAATGGG + Intergenic
908440182 1:64145871-64145893 GCTTCTGTATCAGCAAAAATAGG - Intronic
913614447 1:120543662-120543684 ACTTATGTATGAACAAGAATTGG + Intergenic
914575823 1:148967239-148967261 ACTTATGTATGAACAAGAATTGG - Intronic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
916299797 1:163261317-163261339 CTTTATGTATGAGCAGGAAGGGG - Intronic
918856842 1:189766413-189766435 GCTTATGTATAAGAAAGTATAGG - Intergenic
919249876 1:195040445-195040467 GCTAATGTATGAGCAATAACTGG + Intergenic
924734113 1:246739071-246739093 GTTTGTGTATGTGCATGAATGGG + Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1068518866 10:58057302-58057324 GCTCATGTATGTGCACTAAGAGG - Intergenic
1074265553 10:111899548-111899570 GCTTCTGTGTGAACAGGAATAGG - Intergenic
1081937201 11:46913155-46913177 GCTCATCTGTGAGCAAGAATGGG + Intronic
1083293706 11:61703905-61703927 GCTTAAGTTTGAGGAGGAATGGG + Intronic
1092161931 12:6319944-6319966 GCTGATGTCTGAGCACCATTTGG + Intronic
1101700755 12:107171626-107171648 GCTTGAGTAAGAGCACGAATAGG + Intergenic
1102181000 12:110912217-110912239 GCTTCTGTATGAGCAAGCAATGG - Intronic
1120646707 14:87082871-87082893 GCTTATGTATGAGGAGGAGGAGG - Intergenic
1120739572 14:88092834-88092856 GCTTATGTAGGAGGATAAATGGG - Intergenic
1121891005 14:97590501-97590523 GCTTATGCATGGGCAGGAATTGG + Intergenic
1128425755 15:67541400-67541422 TCTTATGAAGGTGCACGAATTGG - Intergenic
1136101764 16:28001908-28001930 GCCTATGTATAGGCAAGAATGGG + Intronic
1137490947 16:48932178-48932200 GCATGTGTATGAGCAAGAGTGGG - Intergenic
1151244863 17:72786670-72786692 GCTTCTGTATGGGCAGGAAGTGG + Intronic
1153280606 18:3411065-3411087 GCTTCTAAATGAGCACGCATAGG - Intergenic
1155491352 18:26404926-26404948 GGTTGTGTACGTGCACGAATGGG - Intergenic
925535731 2:4914411-4914433 GCTTATGCATGAACTCGCATAGG - Intergenic
934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG + Intergenic
948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG + Intergenic
1173785477 20:45790043-45790065 GCTGAGGTATGAGCAGGACTAGG + Intronic
1177224379 21:18234652-18234674 GCTGATGTATGGGCACAAAGTGG + Intronic
952868535 3:37875846-37875868 TCTAATGTATGAGCACTTATTGG + Intronic
955605571 3:60698939-60698961 GCTTATGTATTAAGATGAATGGG - Intronic
963862851 3:150328741-150328763 CCTTTTCTATGAGCACGAACTGG - Intergenic
964729227 3:159847233-159847255 CGTTATGTATGTGCATGAATAGG - Intronic
965179739 3:165387141-165387163 GCTTATGGATGAAAATGAATAGG - Intergenic
971177538 4:24294106-24294128 GCTTTGGTATGAGCTCGACTTGG - Intergenic
980540585 4:134188268-134188290 GATTATGTATGATCATGAACTGG - Intergenic
982453617 4:155581267-155581289 TCTTATGAATGAGCAAGAAAAGG + Intergenic
987141748 5:14953528-14953550 TCTTCTGTAAGAGCAGGAATGGG + Intergenic
994760546 5:103847131-103847153 GCTTATGTATGAATACGGAGAGG + Intergenic
996443488 5:123517423-123517445 GCGTTTGTATGAGAACCAATTGG + Intronic
997418666 5:133749116-133749138 GCTTCTGTCTGAGCACTAACTGG - Intergenic
998956626 5:147445413-147445435 GCTTATGTACAAGAACAAATTGG + Intronic
999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG + Intronic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
1004673270 6:17817135-17817157 GCTCATGTATGAGCGGGAACTGG - Exonic
1014331606 6:120073934-120073956 GCTCATGTATAAGCAGAAATAGG - Intergenic
1017415520 6:154216515-154216537 GTTTTTGTATGTGCATGAATTGG + Intronic
1022626812 7:32045081-32045103 GCTAATGTATCAGCAGGAGTCGG - Intronic
1038271500 8:26079465-26079487 GCTTATGGATGAGCACATAAAGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1048739763 8:137542153-137542175 GCTTATTTATTAGCTCTAATAGG + Intergenic
1052129043 9:24818175-24818197 GCTTATCTATGAAAACTAATTGG + Intergenic
1194845742 X:98806715-98806737 GATTATGTATGTGCACCAAGGGG - Intergenic