ID: 1038627523

View in Genome Browser
Species Human (GRCh38)
Location 8:29208631-29208653
Sequence CTGAATATTCAAATAGACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038627520_1038627523 10 Left 1038627520 8:29208598-29208620 CCATGTTCTAGGTCAGCGTTGGC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038627523 Original CRISPR CTGAATATTCAAATAGACAA CGG Intronic
No off target data available for this crispr