ID: 1038628429

View in Genome Browser
Species Human (GRCh38)
Location 8:29217171-29217193
Sequence TGCAGGCCTCCTCTACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038628429_1038628440 25 Left 1038628429 8:29217171-29217193 CCACCCTGTAGAGGAGGCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 174
Right 1038628440 8:29217219-29217241 AAGTGTGTCACTCAAGGGTGAGG No data
1038628429_1038628441 26 Left 1038628429 8:29217171-29217193 CCACCCTGTAGAGGAGGCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 174
Right 1038628441 8:29217220-29217242 AGTGTGTCACTCAAGGGTGAGGG No data
1038628429_1038628438 19 Left 1038628429 8:29217171-29217193 CCACCCTGTAGAGGAGGCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 174
Right 1038628438 8:29217213-29217235 CCTGCTAAGTGTGTCACTCAAGG No data
1038628429_1038628442 27 Left 1038628429 8:29217171-29217193 CCACCCTGTAGAGGAGGCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 174
Right 1038628442 8:29217221-29217243 GTGTGTCACTCAAGGGTGAGGGG No data
1038628429_1038628439 20 Left 1038628429 8:29217171-29217193 CCACCCTGTAGAGGAGGCCTGCA 0: 1
1: 0
2: 1
3: 29
4: 174
Right 1038628439 8:29217214-29217236 CTGCTAAGTGTGTCACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038628429 Original CRISPR TGCAGGCCTCCTCTACAGGG TGG (reversed) Intronic
900018191 1:169152-169174 TGCAGGCCACCTCTACGGCCAGG + Intergenic
900048450 1:527748-527770 TGCAGGCCACCTCTACGGCCAGG + Intergenic
900070677 1:769600-769622 TGCAGGCCACCTCTACGGCCAGG + Intergenic
900604674 1:3518641-3518663 TCCAGGCCAGCTCTACAGGGTGG + Intronic
902226617 1:15000236-15000258 TGCAGGCGGCCTCTAAAGGCTGG + Intronic
902302895 1:15515226-15515248 TGCCTGCCTCCTTTACAGGATGG + Intronic
902576713 1:17382575-17382597 TTCAGCCCTCCTCTCCTGGGAGG + Intronic
903182142 1:21610116-21610138 TGATGGCCCCCTCTACAAGGTGG - Exonic
903302633 1:22390241-22390263 TGCAGGTCTCCTCTGCTGGATGG + Intergenic
903360633 1:22774840-22774862 TGCAGACCTCCCCTACATGTGGG + Intronic
903743955 1:25574249-25574271 TGCAGGCCTGGACCACAGGGCGG + Intergenic
905532321 1:38690968-38690990 TGCAGGCAGCATCTACAGCGTGG + Intergenic
905849703 1:41264585-41264607 TGCAGGCCTTTTCAACTGGGAGG - Intergenic
907250274 1:53133523-53133545 TCCAGGACTCCTCTGCAGAGAGG - Intronic
907638217 1:56157912-56157934 AGCAGACCTCCCCTAGAGGGTGG + Intergenic
910740827 1:90514419-90514441 TGCAGCTGTCCTCTAAAGGGAGG + Intergenic
915103257 1:153515779-153515801 TCCAGTCCTCCTCCACAGGAAGG - Intergenic
916012335 1:160717569-160717591 TGCAAGCCTCCTGTCCAGGACGG - Intergenic
920502788 1:206496061-206496083 TGCAGGCCTCTCCAACAGGTGGG + Intronic
920692665 1:208158890-208158912 TGCAGGGCTCCACCACAGGGAGG - Intronic
922106037 1:222515015-222515037 TGCAGGCCACCTCTACGGCCAGG + Intergenic
924348217 1:243092583-243092605 TGCAGGCCACCTCTACCGCCAGG + Intergenic
924446105 1:244133049-244133071 TGCAGGCATCCTCTAGAAAGTGG + Intergenic
924451275 1:244181339-244181361 TCCAGGTCTCCTCCGCAGGGAGG - Intergenic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1065414952 10:25474140-25474162 TGCAGGCAGCCTCTAGAGGCTGG + Intronic
1065954778 10:30684061-30684083 TGCAGGTCTCCTCTGGAAGGGGG - Intergenic
1066728142 10:38412318-38412340 TGCAGGCCACCTCTACGGCCAGG - Intergenic
1067442592 10:46317993-46318015 TGGAGGTCTCCTCTACTGTGAGG + Intronic
1067809909 10:49418258-49418280 AGGAGGCCTCCTTTCCAGGGAGG - Intergenic
1075311667 10:121419572-121419594 TGCAGGGCTGCTCTACAGAGGGG + Intergenic
1076849384 10:133085752-133085774 TTCAGGTCTCATCTCCAGGGTGG - Intronic
1076974793 11:164348-164370 TGCAGGCCACCTCTACGGCCAGG + Intergenic
1077233159 11:1467726-1467748 TACAGGCCTCCTGTTCACGGAGG + Intergenic
1080726384 11:34902763-34902785 TGAAGGCCTTCCCTACAGGAAGG - Intronic
1084789485 11:71464335-71464357 TGAAAGCCCCCTCCACAGGGTGG + Intronic
1087479361 11:98680335-98680357 TGCAGGCATGCTCTGCAGTGTGG + Intergenic
1088413834 11:109567518-109567540 TGCTGGCCTTCTCTGCAGGGAGG - Intergenic
1089402392 11:118171752-118171774 TGCAGGGCCCCGCTGCAGGGTGG - Intronic
1090803782 11:130190159-130190181 TGCCCGCCTCCTCTTCTGGGTGG + Intronic
1091302096 11:134514399-134514421 TGCAGGCTGACTCTCCAGGGAGG + Intergenic
1094708164 12:32935058-32935080 TGGAGGCCTTTTCTACTGGGAGG + Intergenic
1097181988 12:57177111-57177133 TGCAGGCAACATCTACTGGGTGG + Exonic
1100576533 12:95896714-95896736 AGGAGGCCTCCTCTACGGGTAGG - Intronic
1101517692 12:105451927-105451949 TGCAGGCATCCTCCACTGGGAGG - Intergenic
1102247291 12:111363346-111363368 TGCAGGCTTCCTGTACAAGAAGG - Exonic
1103037997 12:117671951-117671973 AGCAGGCCTCCTTCACAGTGGGG - Intronic
1105029450 12:132872687-132872709 CGGAGGCCTCGTCTACAGTGTGG + Intronic
1105545574 13:21348277-21348299 TGCAGGCCTCCTCCACCTGTAGG - Intergenic
1105838355 13:24230742-24230764 TGCAGAACTTCTGTACAGGGTGG + Intronic
1106037081 13:26052500-26052522 TGGAGGCCTCCACCACAAGGTGG + Intergenic
1106562993 13:30862818-30862840 TGCAGGCCTCCCCCAACGGGAGG + Intergenic
1109264295 13:60179105-60179127 TGCAGATCTCCTCAACAGAGAGG - Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1110760265 13:79223398-79223420 TGCTGGCATCCTCTACAGTGAGG + Intergenic
1112748219 13:102552083-102552105 TGCAGGCAGCCTCTAGAGGCTGG - Intergenic
1113122675 13:106941298-106941320 TCCAGCCCTCCTCCACAGTGTGG - Intergenic
1113748634 13:112763645-112763667 TGGAGGCATCCTCTACATGGAGG + Intronic
1115336721 14:32249704-32249726 TGCAAGCCTCCTGTTCAGGAAGG + Intergenic
1118519164 14:66561901-66561923 TGCAGGCAGCCTCTAGAAGGTGG - Intronic
1121464044 14:94102760-94102782 TGCAGGACTGCTGGACAGGGAGG + Intronic
1122151108 14:99726716-99726738 TGGAGGCCCCCTCAGCAGGGGGG - Exonic
1122918254 14:104868647-104868669 TGGCGGCCTCCTCGCCAGGGTGG - Intronic
1124250555 15:28104229-28104251 TGGAGGCCAGCTCCACAGGGTGG - Intergenic
1125504238 15:40257759-40257781 TGGATGTCTCCTCTCCAGGGAGG + Intronic
1126121074 15:45252104-45252126 TGCAGTCCTCCTCTACATTGAGG + Intergenic
1129265596 15:74391655-74391677 TGCAGGCCTGCCCTACCTGGAGG + Intergenic
1129302808 15:74635776-74635798 TGCAGGCCAGGTCTATAGGGTGG + Intronic
1129823401 15:78619553-78619575 TGGTGGCCACCCCTACAGGGTGG - Intronic
1132232819 15:100197082-100197104 TGCAGACCTCCGCTGCAGGGAGG + Intronic
1132997065 16:2828964-2828986 TGGGGGCCTCCCCTCCAGGGAGG + Intergenic
1139321938 16:66121895-66121917 GGCAGGCCTCCTTTAAATGGGGG - Intergenic
1141235663 16:82213605-82213627 TGCAGGCAGCCTCTAGAAGGTGG + Intergenic
1141688101 16:85581753-85581775 TGCAGCCCTCCTCTCAAGGAAGG - Intergenic
1141904326 16:87013523-87013545 CGCAGGCCTCGTTTCCAGGGAGG + Intergenic
1142445469 16:90133309-90133331 TGCAGGCCACCTCTACGGCCAGG - Intergenic
1142462042 17:102161-102183 TGCAGGCCACCTCTACGGCCAGG + Intergenic
1142592303 17:1011736-1011758 AGCAAGCCTCCTCTCCAGGGAGG + Intronic
1144428815 17:15171618-15171640 ACCAGGCCTCCGCCACAGGGCGG - Intergenic
1144853816 17:18257489-18257511 TGCTGGCCTGCCCTGCAGGGTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1147979014 17:44263291-44263313 TGCTGGTCTCTTCTTCAGGGGGG + Intronic
1152206324 17:78976506-78976528 TGCAGACACCCTCTGCAGGGCGG - Intronic
1152539486 17:80967759-80967781 TGCAGGCCTGCTCTAGGGCGGGG - Intergenic
1152579701 17:81160466-81160488 TGCCGGCTTCCTCTGCGGGGGGG + Intronic
1155351487 18:24911722-24911744 TGCAGGACTCCTCTACATGCTGG + Intergenic
1156265481 18:35484456-35484478 TGCAGAACTCCTCTATATGGAGG - Intronic
1157626084 18:49052309-49052331 TGCTGGCTTTCTCTATAGGGAGG - Intronic
1160651747 19:234529-234551 TGCAGGCCACCTCTACGGCCAGG + Intergenic
1162140993 19:8585503-8585525 GGCAGGCCTCCAGTACAGGTGGG + Exonic
1162615571 19:11798149-11798171 GGCAGGTGTCCTCTACAGGGCGG - Intronic
1164587522 19:29485310-29485332 TGCAGACCTCCTCCTCAGGTGGG - Intergenic
1164752730 19:30668669-30668691 TGTAGGTCTCCTCTATAAGGCGG + Intronic
1165321150 19:35085925-35085947 TGCTGGCCTATTCTAGAGGGGGG - Intergenic
1167113667 19:47476452-47476474 TGCAGGCCTCCTCCTGGGGGAGG - Intronic
925005950 2:443197-443219 AGCGGGCCCCCTCTCCAGGGAGG - Intergenic
928335001 2:30390382-30390404 AGCAGGCCACCCCTCCAGGGAGG - Intergenic
928361940 2:30670694-30670716 TGCATGCCTCCACCACAGAGGGG + Intergenic
928948284 2:36791685-36791707 TGCAGGCATCCTCTAGAAGCTGG + Intronic
929997406 2:46837356-46837378 TCCAGGCCTTCTTCACAGGGAGG + Intronic
937324962 2:120984993-120985015 TGCAGGCCCACCGTACAGGGCGG - Intronic
940338564 2:152555386-152555408 TGCCAGCCTCCTCTAGAGAGAGG - Intronic
941010035 2:160288954-160288976 TGCAGGCCACCTAAACAGGCAGG + Intronic
941646933 2:168050628-168050650 TGCAGGCTACCTCTACAAGCTGG + Intronic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
945317985 2:208391486-208391508 TGAAGGACTCCCCTACAGGAAGG + Intronic
946026167 2:216673209-216673231 GGCTGGCCTCCCCTAGAGGGTGG - Exonic
1175503513 20:59466592-59466614 TGCAGGCCTCATCTCCTGGGGGG + Intergenic
1175970761 20:62685567-62685589 AGCAGGCTTTCTCTAGAGGGTGG + Intronic
1178581330 21:33840979-33841001 TGCAGGCCTGCTCTGCAGTGTGG - Intronic
1179036565 21:37763234-37763256 TGCAGGCCCCCCCTACAAGCAGG - Intronic
1179551508 21:42146646-42146668 TGCAGCCCTCCTCCCCAGGAGGG - Intergenic
1179559893 21:42208945-42208967 TGCATTCCTCCTCTCCAGGAGGG - Intronic
1179632020 21:42684517-42684539 TGCAGGACTCCTCGGCAGTGGGG + Intronic
1181651355 22:24260897-24260919 TGCTTCCGTCCTCTACAGGGTGG - Intergenic
1182362689 22:29756299-29756321 TGCAGACCACCCCCACAGGGTGG - Intronic
1182477380 22:30583503-30583525 TGCAGGCCACCAGCACAGGGAGG + Intronic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
950416888 3:12873931-12873953 CCCAGGCCTGCTCTACTGGGTGG - Intergenic
950621508 3:14209436-14209458 CCTATGCCTCCTCTACAGGGAGG + Intergenic
953611512 3:44451028-44451050 TCCAGGAGTCCTCTACTGGGGGG - Intronic
956332169 3:68123439-68123461 GGCAGGACTCCTCTACATTGGGG - Intronic
956883364 3:73533838-73533860 TGCAGGTCACCTCTTCAGTGAGG + Intronic
961217896 3:125175722-125175744 TGCGGGCCATCTCTGCAGGGTGG + Intronic
961617307 3:128193073-128193095 TGCATGAATCCTCTGCAGGGTGG + Intronic
961781976 3:129325634-129325656 CGCTGGCCTCCTCCACAGAGAGG + Intergenic
962399194 3:135042562-135042584 GGCAGCCCTCCTCAGCAGGGTGG - Intronic
964065237 3:152570174-152570196 TGCAGGCCTTCTCTACAGCCAGG + Intergenic
967416761 3:189227367-189227389 AGCAGGACTGCTGTACAGGGAGG + Intronic
967878767 3:194284427-194284449 TCCAGGCCCCCTCTACTGAGAGG - Intergenic
968366085 3:198185439-198185461 TGCAGGCCACCTCTACGGCCAGG - Intergenic
968713211 4:2135894-2135916 TGCAGGCATCCTCTACTGGGAGG + Intronic
969156951 4:5219329-5219351 TGCTGGGTTCCTCTACAGGAAGG - Intronic
969423537 4:7110837-7110859 TGCTGACCTCCTCTGCAGAGTGG + Intergenic
969722508 4:8900337-8900359 TGAAGGCCGTCTCTGCAGGGAGG - Intergenic
970471048 4:16379694-16379716 TGCAAGCCTCCTGTCCAGGAGGG + Intergenic
975448794 4:74500504-74500526 TTCAGGCCTCCTCCACACTGGGG - Intergenic
975741062 4:77429451-77429473 TGTGGGCCTCCTCTAGAGGAAGG + Intronic
979202418 4:117994182-117994204 TGCAGGCCGCCTCTAGAAGCTGG - Intergenic
983412641 4:167419382-167419404 TGAAGGCCTTCCCTACAGGGAGG - Intergenic
985745148 5:1642637-1642659 TCCAGGACTCCTCCACAGGCAGG + Intergenic
986747783 5:10759703-10759725 TGCTGTCCTCCGCTATAGGGCGG - Intronic
991292023 5:65042355-65042377 TGAAGGCCTCACCTTCAGGGTGG + Intergenic
996401675 5:123069504-123069526 TGCAGGTGGCCTCTAGAGGGTGG + Intergenic
996412019 5:123168940-123168962 TGCAGGCATCCTCAACGGTGGGG - Intronic
997257356 5:132439266-132439288 TGCAGTCCTCTTCTGCTGGGAGG - Intronic
997590529 5:135069369-135069391 CGCAGGCCTTCTCTGCATGGCGG - Intronic
998374880 5:141683657-141683679 TGCAGGGGTCCTGTCCAGGGTGG - Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
998854240 5:146379091-146379113 CGCAGGCCTCCGCAGCAGGGAGG - Intergenic
999241463 5:150130274-150130296 TGCAGAACTGATCTACAGGGCGG + Intronic
1002045861 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG + Intergenic
1002549706 5:179978134-179978156 TGTATGCCTCCTTTTCAGGGTGG - Intronic
1002725311 5:181290664-181290686 TGCAGGCCACCTCTACGGCCAGG - Intergenic
1005229385 6:23683146-23683168 AGCAGACCTCCTCCACAAGGAGG + Intergenic
1007104867 6:39276781-39276803 TGCAAGCCTCCTCTCCAGGTGGG + Intergenic
1007967436 6:46015632-46015654 AGCGGGGCTCCTCTTCAGGGCGG + Intronic
1009026230 6:58003604-58003626 TGCAGGCACCCTCTACAGGCTGG - Intergenic
1009201783 6:60755077-60755099 TGCAGTCACCCTCTACAGGCTGG - Intergenic
1009804352 6:68583804-68583826 TGCAGGCATCCTCTAGAAGCTGG - Intergenic
1017180993 6:151551749-151551771 TGCAGCCCTGCTCAACAGGTTGG + Intronic
1018122653 6:160651313-160651335 TGCATGCCTGCACTACAGAGGGG - Intronic
1019443869 7:1060947-1060969 TGCAGCCCAGCTCTGCAGGGTGG + Intronic
1019742747 7:2682833-2682855 TGCAGGCATTCTGTACAGGGAGG + Intronic
1024249474 7:47495469-47495491 TGCAGGCCTCGTCCTCAGGGCGG - Intronic
1030405188 7:109101552-109101574 TGCAGACATCCTCTAGAGGCTGG + Intergenic
1030972275 7:116075444-116075466 TGCTTGCCTTCTCAACAGGGAGG + Intronic
1032012570 7:128356579-128356601 AGCAAGCCTCCTTTACTGGGAGG + Intronic
1032546769 7:132750496-132750518 TGCAGGTCTCCTGTGCAGGGCGG - Intergenic
1035682499 8:1498211-1498233 TGGAGGCTTCCTCTGCACGGTGG - Intergenic
1036216453 8:6883714-6883736 TGGGGGCTTCCTCTTCAGGGAGG + Intergenic
1036746647 8:11414627-11414649 TGCAGTTCTCCTCTACTTGGGGG + Intronic
1036919302 8:12836163-12836185 AGCAGCCCTCCACTACAGAGAGG + Intergenic
1037800755 8:22033951-22033973 TGCCTGCCACCTGTACAGGGCGG - Intronic
1038380346 8:27086983-27087005 TGCAGGACGCCTCTCCAAGGTGG - Intronic
1038414106 8:27380721-27380743 TGCAGGCCTCCCTCCCAGGGCGG - Intronic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1039643898 8:39257959-39257981 TGTAGACATCCTCTACAGGGAGG - Intronic
1039987794 8:42462380-42462402 TGCATGCTTCCTCTGCAGGCAGG - Intronic
1040360041 8:46656444-46656466 TGCAGGACTGCTCTCCAGGGAGG + Intergenic
1042343346 8:67703349-67703371 TGCTGGCCTCCTGTCCAGGAGGG - Intronic
1043447734 8:80335668-80335690 TGCCGGCCGTCTCTACAGGTTGG - Intergenic
1045323485 8:101099473-101099495 TGCAGGTGTCTTCTAGAGGGTGG + Intergenic
1048986292 8:139736898-139736920 TGCAGCCCTGCTCAGCAGGGTGG - Intronic
1049351994 8:142169578-142169600 TGCTGGTCCCCTCTCCAGGGAGG - Intergenic
1049352292 8:142170737-142170759 TGCAGGCCTTCTGTCCAGGGAGG + Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1050358403 9:4804614-4804636 CGGAGGCCTCCTCTACAGCCGGG - Intronic
1057310375 9:93939219-93939241 TGCAGGTCTCCTGCACACGGTGG - Intergenic
1058788496 9:108416674-108416696 TGCTGGCCTCCTTGACAGGTGGG - Intergenic
1058861510 9:109121470-109121492 TGCATGCCTTATCTACTGGGTGG + Intergenic
1058987162 9:110219081-110219103 AGCAGGGCTCCTATACAGGAGGG + Intergenic
1061020039 9:128008417-128008439 TGCAGGCAGCCTCTAGAGGCTGG + Intergenic
1061445036 9:130632757-130632779 TGCATCCCGCCTCTCCAGGGAGG + Intronic
1061488245 9:130931128-130931150 AGCAGGCCTCTTCTCCAGGGTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062148384 9:135004041-135004063 TGCAGTCCTCCCTTTCAGGGAGG - Intergenic
1062750454 9:138248306-138248328 TGCAGGCCACCTCTACGGCCAGG - Intergenic
1186223594 X:7375019-7375041 TGCAGGTCTCCTCTCCACTGAGG - Intergenic
1186329267 X:8514797-8514819 AGCAGGTCGCCTCTACAGGCTGG + Intergenic
1187300592 X:18045560-18045582 TGCAGGCCTGCTCTAAGGGTTGG - Intergenic
1187815428 X:23226540-23226562 TGAAAACCTCCTCTCCAGGGAGG + Intergenic
1190626725 X:52344217-52344239 TGCTGTTCTCCTCTACAGGGTGG - Intergenic
1190701283 X:52991612-52991634 TGCTGTTCTCCTCTACAGGGTGG + Intronic
1200084551 X:153597427-153597449 TGCAGCCCTCCTCTAGAAGCTGG - Intronic