ID: 1038630415

View in Genome Browser
Species Human (GRCh38)
Location 8:29237938-29237960
Sequence TAATTTTATTAGAGTACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038630415_1038630420 -3 Left 1038630415 8:29237938-29237960 CCCACTGTACTCTAATAAAATTA 0: 1
1: 0
2: 1
3: 29
4: 290
Right 1038630420 8:29237958-29237980 TTAGCAGGACGGGCTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038630415 Original CRISPR TAATTTTATTAGAGTACAGT GGG (reversed) Intronic
902100897 1:13987868-13987890 TAATTTTTTTACAGTACTGGAGG + Intergenic
905110814 1:35593172-35593194 TAATTTTTTTTTAGTACAGATGG - Intronic
907125770 1:52049417-52049439 TAATTTTTGTAGAGTAGAGACGG - Intronic
907808281 1:57842869-57842891 CATTTATATTAGTGTACAGTTGG + Intronic
908150279 1:61293645-61293667 AAATTGAATTAGAGTAAAGTGGG - Intronic
908521480 1:64947446-64947468 TGATTTGAATAGAGAACAGTTGG - Intronic
909139748 1:71848607-71848629 TAATTTTATTTCTGAACAGTAGG - Intronic
911825043 1:102472260-102472282 TAATTTTATTGAAGTAAAGTTGG - Intergenic
912098774 1:106179954-106179976 TGATTTTATTAGATATCAGTGGG + Intergenic
912217893 1:107636553-107636575 TAATTATATTAGCCCACAGTTGG + Intronic
914710293 1:150207080-150207102 TATTTTTATTATAGTAGAGATGG + Intergenic
915619218 1:157069476-157069498 TAATTTTAAGAGAGGACAGCAGG + Intergenic
917858102 1:179118407-179118429 TACTTTAATCAGAGTACAGTAGG + Intronic
917930503 1:179819330-179819352 TAATTTTCATGGAATACAGTGGG - Intergenic
919327987 1:196133803-196133825 TAATTTTACTAGTGTAAAGGGGG + Intergenic
920882385 1:209892442-209892464 TAATTGCATTAAAGTACAGTTGG - Intergenic
921338273 1:214109653-214109675 TATTTTTATTATAGTAGAGTAGG + Intergenic
921903222 1:220469725-220469747 TCATTATATTAGAATACAGTAGG + Intergenic
921997403 1:221436257-221436279 TAACTTTCTCAGAGTACACTTGG + Intergenic
922640362 1:227223917-227223939 TTATGTTATTAGCCTACAGTGGG - Intronic
923182457 1:231532931-231532953 TAATTTTCTTAGAATACAAATGG - Intronic
923841249 1:237672919-237672941 TAATGGTATTAAAGTTCAGTGGG + Intronic
1064571627 10:16699367-16699389 TAATATAATTAGAGTAAAGCTGG + Intronic
1064631698 10:17320833-17320855 TAATTTTAATATAATGCAGTAGG - Exonic
1064846615 10:19662369-19662391 TAATTTCATTACAGAACAGCAGG + Intronic
1065225150 10:23536025-23536047 CAATTTTAATAGAGTAAATTTGG + Intergenic
1066479523 10:35782107-35782129 TTATTCTATTATAGTTCAGTTGG + Intergenic
1066624555 10:37392819-37392841 TCAGTTTATGACAGTACAGTAGG + Intergenic
1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG + Intronic
1069343210 10:67437445-67437467 TAAATTTATTGGGGTACAGATGG - Intronic
1069379916 10:67832418-67832440 TCATTTGATTAGAGTAATGTAGG - Intronic
1069731479 10:70618102-70618124 TATTTCTATTAAAGAACAGTGGG + Intergenic
1073994981 10:109305152-109305174 TAAGTTTAACATAGTACAGTTGG - Intergenic
1074621305 10:115125937-115125959 TCATTTTACTAGATTTCAGTTGG + Intronic
1074636305 10:115322223-115322245 TAATTTTATTAAAGTACTGTTGG - Intronic
1075935756 10:126339810-126339832 AAATTTTATTTGAGTGAAGTGGG + Intronic
1076115802 10:127898525-127898547 TAATTTTATAAGACTATAGGGGG + Intergenic
1079371683 11:19859063-19859085 TAATTTTCTTAGAGTCTTGTGGG + Intronic
1079481061 11:20880729-20880751 TCATTTAAATAGAGTCCAGTTGG + Intronic
1079694022 11:23456342-23456364 TAGGTTTATTAAAATACAGTCGG + Intergenic
1079946276 11:26745704-26745726 TTATTTCATGAGAGTACAGGTGG - Intergenic
1080112507 11:28584033-28584055 TAATCTCATTTGATTACAGTTGG - Intergenic
1080493026 11:32787883-32787905 TAATTTTATTAGATTATAAAAGG - Intronic
1081735674 11:45401816-45401838 TATTATTATTAGAGTGCAGTGGG + Intergenic
1082201447 11:49375461-49375483 TAATTTAATGAAAATACAGTTGG + Intergenic
1083499947 11:63095807-63095829 TAATATTATGACAGGACAGTGGG - Intronic
1083978611 11:66145290-66145312 TAATTCTGTTAGGGTACAGCAGG + Intronic
1085213842 11:74809647-74809669 TAATTTTATAATAGTAGAGATGG - Intronic
1085369339 11:75984393-75984415 CACTTTTATTAGCTTACAGTTGG - Intronic
1086654220 11:89330784-89330806 TAATTTAATGAAAATACAGTTGG - Intronic
1086730824 11:90247110-90247132 TAATTTTGTTGGAGCACAGCAGG + Intergenic
1086775390 11:90825095-90825117 GAATTTTATTGGAGTAAAGATGG + Intergenic
1086782148 11:90920884-90920906 TACTTGTATTAGCCTACAGTTGG - Intergenic
1087515057 11:99148728-99148750 TAATTATATTAAATTACATTTGG - Intronic
1088861619 11:113805554-113805576 GAATTTCTTAAGAGTACAGTAGG - Intronic
1090535918 11:127641522-127641544 TTATTTTATTTGTTTACAGTAGG + Intergenic
1092867446 12:12776140-12776162 TATTTTTAGTAGAATTCAGTCGG - Intronic
1093343161 12:18004530-18004552 TTATGTTATTAGAGTAATGTTGG - Intergenic
1095436943 12:42199754-42199776 TAATATTAGAATAGTACAGTTGG - Intronic
1095477370 12:42599379-42599401 TATTTTTATTAGAGTACTAAGGG + Intergenic
1096315666 12:50562993-50563015 TAATTTTATTAGAGTATTATAGG - Intronic
1097355864 12:58601195-58601217 TAATTTTATTAGGGTTAAATAGG + Intronic
1098024115 12:66184852-66184874 TAGTTTTAGTGGAGTAAAGTGGG + Intergenic
1098028271 12:66228843-66228865 CAATTATATTAGCCTACAGTTGG - Intronic
1098255041 12:68608008-68608030 TAATTTTATTTTGGTAGAGTGGG + Intergenic
1098984464 12:76996800-76996822 TACTTTTATTAGCCTACAGCTGG + Intergenic
1099455334 12:82856322-82856344 GAAGTTTATTAGAATGCAGTAGG + Intronic
1101274849 12:103188305-103188327 TAAGTTTATTGGGGTACAGGTGG + Intergenic
1102636327 12:114327461-114327483 TAATTGTATTAGGGTAGACTAGG - Intergenic
1104184466 12:126416636-126416658 TAATTTTATTACTGTAGAATTGG - Intergenic
1104885754 12:132106609-132106631 TAATTTTTTTAGAGTATACATGG + Intronic
1105493408 13:20909112-20909134 AATTTTTTTTACAGTACAGTTGG - Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1111006479 13:82256344-82256366 TAATTTTATTCAAGAGCAGTGGG - Intergenic
1111427671 13:88109449-88109471 TAGTTCTAATAGAGTACAATGGG + Intergenic
1111494266 13:89027522-89027544 TGATTTTATTACAGTAAATTAGG - Intergenic
1113158575 13:107353216-107353238 CAATTTTATTAGTGTGCAGGAGG - Intronic
1113527078 13:110988353-110988375 TAATTTTAGTAAAGTTCTGTAGG + Intergenic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1116548415 14:46201851-46201873 TAATTTAATAAGAGTAAAGAAGG + Intergenic
1119061367 14:71478392-71478414 TCTTTTTTTTAAAGTACAGTGGG + Intronic
1119115787 14:72020087-72020109 GAATTTTCTCAGTGTACAGTAGG + Intronic
1120295297 14:82632925-82632947 TAATCTTATCAGAGTAGAGAAGG + Intergenic
1125905910 15:43392385-43392407 TAATTTTATTGCATTATAGTTGG + Intronic
1127675102 15:61230576-61230598 TAATATTATTAGAGGCCAGAAGG + Intergenic
1129615434 15:77095633-77095655 TTATTTTATTAAAGTACAGCTGG + Intergenic
1130009438 15:80137858-80137880 TAATTTTAGTTGAGTGCAGAGGG + Exonic
1130668192 15:85887286-85887308 TAATTTTCTTATTGTACAGATGG - Intergenic
1131500951 15:92965772-92965794 TAATATAATAAGAGTACAGTAGG + Intronic
1131723034 15:95191911-95191933 TATTTTTGCTTGAGTACAGTTGG + Intergenic
1135479134 16:22806717-22806739 TAATTTTATGAGTACACAGTAGG - Intergenic
1135839154 16:25858209-25858231 TAATTTTATAAGTGTAGAGAAGG - Intronic
1136035444 16:27536419-27536441 TATTTTTAGTAGAGTTTAGTAGG - Intronic
1136937115 16:34481319-34481341 TTATTCCATTAGAGTACATTTGG - Intergenic
1136962704 16:34867251-34867273 TTATTCCATTAGAGTACATTTGG + Intergenic
1137340622 16:47600247-47600269 TTATTTTTTAAGAGCACAGTGGG - Intronic
1137777558 16:51069144-51069166 TATTTTTATTAGAGCTCTGTCGG - Intergenic
1138323186 16:56137035-56137057 CAATTTTTTTAGAGTACTGTAGG - Intergenic
1139042418 16:63014062-63014084 TAATATTTTCAGACTACAGTTGG + Intergenic
1140597021 16:76428270-76428292 CACTTTTATTATAGAACAGTGGG + Intronic
1142410191 16:89912101-89912123 TAATTTTATTAGAGAACTTGAGG + Intronic
1142911462 17:3097018-3097040 TAATTTTATTCTACTGCAGTGGG - Intergenic
1144699826 17:17329803-17329825 TAATTTTTTTTTAGTACAGATGG - Intronic
1146895693 17:36540184-36540206 TAGTTTTATTAAATTACACTGGG - Intronic
1148050763 17:44769017-44769039 TAAATTTTTCAGAGTGCAGTGGG - Intronic
1148879123 17:50712191-50712213 TACTTTAATTAGCCTACAGTTGG - Intergenic
1149118224 17:53126176-53126198 TAATGTTTTAGGAGTACAGTAGG - Intergenic
1149228256 17:54500513-54500535 TATTTTGATAAGAGAACAGTTGG + Intergenic
1149302188 17:55315733-55315755 TAATTTTATTAGACTTTTGTGGG - Intronic
1149813660 17:59702914-59702936 TTAATTTATTAGCGTACAATAGG - Intronic
1150900225 17:69266684-69266706 AAATTTTATTATTGTGCAGTGGG + Intronic
1151085848 17:71379796-71379818 TAATTTAATTAGAATACAATTGG - Intergenic
1152254947 17:79233509-79233531 TAGTTTTATTGAAGTACATTGGG - Intronic
1153533267 18:6071425-6071447 TAATGTTATTAGTGTTAAGTTGG - Intronic
1155415611 18:25596181-25596203 TAATTTTAGTAGTGTACAGGTGG - Intergenic
1155502481 18:26500689-26500711 TAATTTTATAGGAGATCAGTTGG - Intronic
1156332337 18:36134389-36134411 TGATTTTATTAGAATATAGCTGG - Intronic
1156360369 18:36379373-36379395 TAATTTAATTAAAGTAAAATGGG - Intronic
1156581757 18:38385279-38385301 TTATTCTATTCGAGTGCAGTAGG - Intergenic
1158298623 18:56027614-56027636 TATTATTATTAAAGTACAGGTGG - Intergenic
1159244570 18:65789149-65789171 GAATTTTATTAATGTGCAGTGGG + Intronic
1159510201 18:69388134-69388156 TAATCTTTTTAGACTACAATAGG - Intergenic
1162853670 19:13451489-13451511 AACTTTTATTAGATTCCAGTAGG - Intronic
1163036117 19:14570065-14570087 TATTTTTAGTAGAGTAGAGACGG + Intronic
1165562427 19:36691333-36691355 TTATTTTATTTTTGTACAGTTGG + Intronic
1166530335 19:43539015-43539037 TAATTTTATTATAGTTCTGGAGG - Intergenic
1166624852 19:44342132-44342154 TAATTTTATTAGAGTAATACAGG - Intronic
1166731675 19:45062552-45062574 TATTTTTAGTAGAGTTTAGTAGG + Intronic
1166831619 19:45642788-45642810 TAATTTTATTTTAGTAGAGACGG - Exonic
925782716 2:7397449-7397471 TAATTTTATTAGAGTAAGAGAGG + Intergenic
927037872 2:19199807-19199829 TACTTTTATTTTAGTTCAGTGGG - Intergenic
927259568 2:21073601-21073623 TTATTTTTTTAAAGTAAAGTTGG - Intergenic
927294404 2:21437832-21437854 TAATTTTAATAAATTACATTGGG - Intergenic
928354171 2:30594000-30594022 TAATTTTTTTAGTGTATAGGTGG - Intronic
930354762 2:50304263-50304285 AATTTTTATTAGAATACAATAGG + Intronic
930515674 2:52404796-52404818 TAGTTCTATTATAGTACTGTGGG + Intergenic
930916848 2:56702088-56702110 TAATTTTGATAGAGCAAAGTGGG - Intergenic
931334557 2:61326397-61326419 TATTTTTATTATAGTAGAGACGG + Intronic
932836528 2:75043220-75043242 TAATTTAATTTGAGAACAATGGG - Intergenic
932993712 2:76821426-76821448 TAATTTTATTAGAACTCAGGAGG - Intronic
936582028 2:113708973-113708995 GTATTATATTTGAGTACAGTTGG - Intronic
936629614 2:114187787-114187809 TAAATTTCTTATAGTACAGGTGG + Intergenic
936882071 2:117265686-117265708 TACTTTAAATAGAGTGCAGTTGG - Intergenic
937519245 2:122691478-122691500 AAGTTCTATTAGAGTACAGAGGG + Intergenic
939727509 2:145741133-145741155 TAATTTTAATAAAGTTCTGTGGG + Intergenic
941435733 2:165468898-165468920 TAAGTTTATTAGAATAAAATTGG + Intergenic
942253725 2:174070704-174070726 TAATTTGAGTAGAGTACAGAGGG - Intergenic
942357258 2:175130544-175130566 TATTTTCATAACAGTACAGTAGG - Intronic
942373991 2:175316977-175316999 CACTTTTATTAGACTACAGTTGG - Intergenic
942787171 2:179713072-179713094 CACTTTTATTAGCCTACAGTTGG - Intronic
943163833 2:184290692-184290714 TCAATTTATTAGAAAACAGTTGG + Intergenic
943424791 2:187717940-187717962 TTATTATATTAGAGTACTCTTGG + Intergenic
944297186 2:198079243-198079265 TAATTTTATTAAACTAAAATTGG - Intronic
944776464 2:202971431-202971453 TAATATTATTAGACCAAAGTAGG - Intronic
946278988 2:218652394-218652416 TAATATTCGTAGAGTACAGATGG + Intronic
947113071 2:226740821-226740843 TCATTTTTTTAAAGCACAGTTGG - Intronic
947879837 2:233498065-233498087 TAATTTTATCACAGGAGAGTTGG - Intronic
1169268940 20:4184487-4184509 TTTTTTTTTTAGTGTACAGTTGG - Intronic
1170219529 20:13927176-13927198 TAACGTTTTTAGAGTACATTTGG - Intronic
1170242666 20:14186201-14186223 TAATTTTATTTGTGTTCACTAGG - Intronic
1170266927 20:14477316-14477338 TGATTTTCTTAGAGAACACTTGG - Intronic
1170682837 20:18542212-18542234 TCATTTTAGAAGAGTACAGTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172571179 20:35972048-35972070 TTATTATATTACAGTACTGTAGG + Intronic
1173017643 20:39240075-39240097 TAATTTTATAGGATTACAATGGG + Intergenic
1178788885 21:35679746-35679768 TACTTTTATCAGAGCACAGCTGG - Intronic
1180236539 21:46463405-46463427 TTGTTTTAATAGACTACAGTGGG + Intronic
1184631852 22:45787709-45787731 TAATTTTAACAGAACACAGTAGG + Intronic
1203327864 22_KI270738v1_random:45165-45187 TAATTCTATTAGATTCCATTCGG - Intergenic
949748475 3:7323897-7323919 TAATTTTGATAGATTATAGTGGG - Intronic
951549976 3:23867517-23867539 TAATTATCTTAGATAACAGTTGG + Intronic
951944570 3:28120653-28120675 TAATTTTTCTACAGCACAGTAGG - Intergenic
952557160 3:34545453-34545475 TAAATGTATTAGAAAACAGTGGG + Intergenic
953093790 3:39755080-39755102 CAATTATATTAGAGCAGAGTTGG + Intergenic
953807130 3:46080241-46080263 TATTTTTATGAGATTTCAGTTGG - Intergenic
955421333 3:58741127-58741149 AAAATTTATTGGTGTACAGTTGG - Intronic
955798601 3:62663291-62663313 AAATTCTATTAGAATATAGTGGG - Intronic
956050093 3:65238447-65238469 CAATTTTATTGAACTACAGTTGG + Intergenic
957711729 3:83869209-83869231 TAATTTTATTGAAGGACAGATGG + Intergenic
957875795 3:86144617-86144639 TAATTAAATTGTAGTACAGTTGG - Intergenic
959589676 3:108064341-108064363 GAATTTTCTTAGAGTAGAGTAGG - Intronic
960050002 3:113230071-113230093 TAATGTTATCAGAGAACAGAAGG + Intronic
960556171 3:119033433-119033455 TAACTTTTCTAGAGTTCAGTAGG - Intronic
962036281 3:131655010-131655032 TAATTGAATTGGAGTGCAGTGGG + Intronic
962511431 3:136104910-136104932 TAATTTTTTTAGAGTAAAAATGG - Intronic
963535107 3:146518006-146518028 TCATTTTATTTGAGTACAAGTGG + Intronic
963959275 3:151290180-151290202 GAATTATGTTAGAGTACGGTCGG - Intronic
964337107 3:155667238-155667260 GGATTTTTTTAGTGTACAGTGGG - Intronic
964523650 3:157594151-157594173 CAGTTTTGTTAGAGTAGAGTAGG + Intronic
966365568 3:179183408-179183430 TACGTTCATTAGAGTATAGTTGG + Intronic
967672119 3:192249112-192249134 TAATATTATAATAGTACAGTGGG - Intronic
968352063 3:198066106-198066128 AAGTTTTATGAGAGTACAGTTGG + Intergenic
970076534 4:12227987-12228009 TAATTTTATGAGTATATAGTAGG - Intergenic
970471661 4:16385430-16385452 TAATTCAATCAGAGTGCAGTGGG + Intergenic
970534736 4:17019304-17019326 GGATTTTATTAGAATGCAGTAGG + Intergenic
972040399 4:34588634-34588656 TAGTTTTATTAGAGAACTGAGGG + Intergenic
972526735 4:39920914-39920936 TTAATTTATTTGAGTACATTGGG - Intronic
973718174 4:53698542-53698564 TATTTTTATTAAAGAACAATAGG - Intronic
974943761 4:68501552-68501574 CAATTTTATTAAAGTATAATTGG + Intergenic
975315293 4:72945336-72945358 TAATATTTTCAGACTACAGTTGG - Intergenic
976097967 4:81528815-81528837 TAGTTTGATTAAAGAACAGTGGG - Intronic
976942865 4:90727897-90727919 TAAATATAATACAGTACAGTAGG - Intronic
977064546 4:92297020-92297042 TCATTTTATCAGAGCACAGAAGG - Intergenic
977066690 4:92326121-92326143 TAATTTTATAAAAGAACAGTTGG - Intronic
978170868 4:105668355-105668377 TATTTTTAGTAGAGTTTAGTAGG + Intronic
979177829 4:117686646-117686668 TAATTTTATATGCATACAGTTGG - Intergenic
979349982 4:119632203-119632225 GAATTTTATTTTAGCACAGTGGG - Intergenic
979497702 4:121402789-121402811 TAATTTTATTACAGTTCTGTAGG + Intergenic
979843736 4:125481377-125481399 TTATTTTTTAAGAGTAGAGTTGG + Intronic
980272457 4:130603338-130603360 CACTTTTCTTAGAGTTCAGTGGG + Intergenic
980661140 4:135859812-135859834 TAATTTTTTAAGAGTTCAATAGG - Intergenic
982937479 4:161500510-161500532 TACTTTTATTAGAGTTCACTAGG + Intronic
983115548 4:163811669-163811691 CAATTTTATTAGAAAAAAGTAGG + Intronic
983446222 4:167856341-167856363 TTATTTTATTAAGGTAGAGTTGG - Intergenic
985251270 4:188026859-188026881 TAATTTTATTAAAGTCTAGTTGG - Intergenic
986672899 5:10158933-10158955 TAATTTTTTAAGTGTACTGTGGG - Intergenic
987521938 5:18997130-18997152 TAATTTTATTAGAGTTGTTTTGG + Intergenic
987978376 5:25045641-25045663 TATATTTATTAGGGTATAGTAGG - Intergenic
987994226 5:25253782-25253804 TAATTTTATTTTCCTACAGTGGG + Intergenic
989556185 5:42797974-42797996 TAATTTTTTTTTAGTACAGGCGG - Intronic
990074271 5:51823497-51823519 TAATATTATTAGAATAAAATAGG - Intergenic
990402320 5:55451419-55451441 TAAAATTATTAGAGCCCAGTAGG + Intronic
990938508 5:61176466-61176488 TAATTTTAAGACAGTCCAGTTGG + Intergenic
993094631 5:83467385-83467407 TTATTTAATTAGACTACAGTGGG - Intergenic
993428244 5:87797781-87797803 TAATTTTATTAGTGTAAAAGTGG + Intergenic
994854370 5:105098262-105098284 AAATTTATATAGAGTACAGTTGG - Intergenic
994898062 5:105731029-105731051 AGATTTTATTAGAGCAAAGTAGG + Intergenic
995334058 5:110978293-110978315 TTATTTTACTACAGTCCAGTGGG - Intergenic
995377926 5:111498479-111498501 TGTTTTTATTAGCGTAGAGTAGG - Exonic
997059408 5:130482945-130482967 TAAGTTTCTTAGAACACAGTAGG + Intergenic
998099340 5:139419060-139419082 TAATTTTATCAGACTCCATTAGG + Intronic
998544970 5:143019753-143019775 TAATCTTTTTAGAGTTAAGTAGG - Intronic
999858397 5:155619788-155619810 CAATTTTATTAGACTTCAGGGGG + Intergenic
1003102287 6:3186072-3186094 TAATTTTACTAGAGTAATGATGG + Intergenic
1003324377 6:5081608-5081630 TATTTTTATTATACTACAGGAGG - Intergenic
1004974306 6:20947702-20947724 CACTTTTATTAGCCTACAGTTGG + Intronic
1005662570 6:28014151-28014173 CAAATTTATTAGAGTTCTGTAGG - Intergenic
1007457905 6:41994763-41994785 TTATTTTTTTAGAGTAGATTTGG - Intronic
1007673689 6:43577646-43577668 AACTTTTTTTAGAATACAGTTGG + Intronic
1008413464 6:51211379-51211401 TAATGTTATTTTAGTATAGTTGG - Intergenic
1008816421 6:55572276-55572298 TCATTTTATTAGCATAAAGTTGG - Intronic
1008826966 6:55707534-55707556 AAATTATATTAGAAGACAGTAGG + Intergenic
1010267889 6:73887265-73887287 CAATTTTATTATAGTTTAGTGGG - Intergenic
1011094773 6:83648642-83648664 TAATTTTAGTTGAGTCTAGTAGG + Intronic
1011580384 6:88857174-88857196 TAATTTTATTAATGTATATTTGG - Intronic
1012403314 6:98863567-98863589 AGCTTTTATTAGAGTACAATGGG - Intergenic
1012424697 6:99101104-99101126 TATTTTTATTGGAGTAGTGTAGG + Intergenic
1012536398 6:100303165-100303187 TAATGTTTTTGGGGTACAGTTGG + Intergenic
1013465649 6:110415066-110415088 TAATTTGATTGCTGTACAGTGGG + Intronic
1013628477 6:111961238-111961260 TCTATTTCTTAGAGTACAGTGGG + Intergenic
1014090397 6:117398135-117398157 TAATTATATTATAATTCAGTGGG - Intronic
1014617314 6:123619246-123619268 TAATTTGGTTAGAGTTCAGCAGG + Intronic
1015625650 6:135179245-135179267 TAATTTTATTAGGCTAATGTTGG - Intergenic
1016192890 6:141292869-141292891 TATTTTTATTAAAGTATAATTGG + Intergenic
1016358673 6:143245168-143245190 TTATATTAGTAGAGTATAGTTGG + Intronic
1016589905 6:145733381-145733403 TAATTTTATGAGCATCCAGTAGG + Intronic
1016866353 6:148771518-148771540 TAATTTTGTTAAAATATAGTTGG + Intronic
1018194605 6:161344091-161344113 TAAATTAATTAGCATACAGTAGG + Intergenic
1018515709 6:164577917-164577939 TATTTTTAGTAGAGTAGAGATGG - Intergenic
1020036485 7:4966378-4966400 TATTTTTAGTAGAGTAGAGATGG - Intergenic
1022597610 7:31727701-31727723 TAATTTTTTTAGACTACAATGGG + Intergenic
1023427877 7:40058292-40058314 AAATTTTATTTGATTGCAGTGGG + Intronic
1023428243 7:40062450-40062472 TAATTTTTTTTTAGTACAGATGG + Intronic
1024826243 7:53394024-53394046 TAGTTTTATTAAAGTAGAGTTGG + Intergenic
1024914048 7:54479011-54479033 TAATTTTATTCTTTTACAGTTGG + Intergenic
1027591331 7:80122603-80122625 ATATTTTATCAAAGTACAGTTGG - Intergenic
1028394565 7:90353279-90353301 TAATTTTAGAAGAAAACAGTGGG - Intronic
1028738633 7:94247223-94247245 AAATTTTATTAGAGAAGATTTGG + Intergenic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1030464751 7:109886695-109886717 TTATTTTATTAAAATACACTTGG + Intergenic
1030590453 7:111474934-111474956 TAGTATTATGACAGTACAGTAGG - Intronic
1030733382 7:113016938-113016960 TAATTTTGTTACAGTATATTAGG + Intergenic
1030929905 7:115509830-115509852 TAATTTTCTTAGAGTTCTGGAGG + Intergenic
1031209975 7:118811080-118811102 TGATTTGATTTGAGTAGAGTAGG + Intergenic
1031558082 7:123203021-123203043 TGATATTATTTGAATACAGTTGG - Intergenic
1031778849 7:125937960-125937982 GAATTTTATTAGAATAAATTAGG - Intergenic
1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG + Intergenic
1038630415 8:29237938-29237960 TAATTTTATTAGAGTACAGTGGG - Intronic
1040021295 8:42743690-42743712 TAATTTAAGTAGATAACAGTAGG - Intergenic
1041906922 8:63043360-63043382 TAATTTAATAATATTACAGTAGG - Intergenic
1042230515 8:66549678-66549700 TACTTTTATTTGAGAAAAGTTGG - Intergenic
1044761621 8:95523350-95523372 TGATTTTATTACAGGAGAGTAGG + Intergenic
1046049584 8:109007079-109007101 TAATTTTATTCGAGTAAGGAAGG - Intergenic
1048778470 8:137974328-137974350 TAATTTTATAATAGCACAGGTGG - Intergenic
1050111471 9:2221220-2221242 TAATTTTAATGAAGTTCAGTTGG + Intergenic
1050947658 9:11546560-11546582 TAAGTGTATTAGAGAAAAGTAGG + Intergenic
1051408472 9:16764391-16764413 TAATTTTTTTAAAGTTCAGGAGG - Intronic
1052467685 9:28850753-28850775 GAATTCTATTAGAGTAGGGTAGG - Intergenic
1052539937 9:29797256-29797278 TAATTGTATTTCAGTACAATAGG + Intergenic
1052646875 9:31247572-31247594 TAAATATATTAGAGATCAGTAGG - Intergenic
1053109953 9:35450587-35450609 TAATTTTAGTTGAGTGCAGAGGG + Intergenic
1056044152 9:82699477-82699499 TAACTATACTAGAATACAGTTGG - Intergenic
1056432601 9:86542983-86543005 TACTTTTATTAGAGTAAATATGG + Intergenic
1057471233 9:95358516-95358538 TAATTTTATTAAGGTAAATTAGG - Intergenic
1057539572 9:95953922-95953944 CAATTTTATTCAAGTACATTTGG + Intronic
1058155237 9:101507377-101507399 TAACTTTATTAGGAGACAGTTGG - Intronic
1058555381 9:106161104-106161126 TATTTTTACTAGAGAACAGAAGG + Intergenic
1058980203 9:110161873-110161895 TATTTTTATTAGTGAACAATAGG + Intronic
1059053131 9:110950287-110950309 TATTTTTATTATAGTAGAGATGG - Intronic
1059613223 9:115921653-115921675 TCATTTCTTTAGAGCACAGTTGG + Intergenic
1059684839 9:116625256-116625278 TATTTTTAGTAGAGTAGAGATGG - Intronic
1059786566 9:117592749-117592771 TTATTTAGTTAGAGTACAGCTGG + Intergenic
1060134032 9:121134268-121134290 TAATGATATTAGAGGACATTAGG - Intronic
1060447519 9:123704950-123704972 AAATTTGATTAGAATACATTAGG - Intronic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1187162311 X:16775922-16775944 TACTTATATTAGCCTACAGTTGG + Intergenic
1187575684 X:20552033-20552055 TAATTTTATTACATTATAGTAGG - Intergenic
1188970289 X:36606990-36607012 TAGTATTGTGAGAGTACAGTTGG + Intergenic
1189127446 X:38463169-38463191 AAATTTTATTGGAATACAGTGGG - Intronic
1189585562 X:42458251-42458273 TAGTTTTATTGGGGTACAGGTGG + Intergenic
1189765893 X:44371598-44371620 TAATTTCATAAGAATACAGTTGG + Intergenic
1190783914 X:53625345-53625367 TAATTTTATTATAGTGTATTTGG - Intronic
1191141108 X:57117751-57117773 GCATTTTATTAGAGTAAAGCAGG + Intergenic
1193406771 X:81109819-81109841 TAATTTAATTATAGCACAGGAGG + Intergenic
1194017846 X:88647700-88647722 CAATCTTATTAGAATACGGTTGG + Intergenic
1194877816 X:99210784-99210806 TAAGTTTTTTAGAATACATTTGG + Intergenic
1195281085 X:103333632-103333654 TAATCTTATTAACATACAGTGGG + Intergenic
1195462065 X:105138718-105138740 GAATATTCTTAGAGTCCAGTGGG + Intronic
1197695632 X:129547046-129547068 TAATTTTATTTTTGTACAGATGG - Intronic
1198374257 X:136022034-136022056 TAAACTTAGTGGAGTACAGTGGG + Intronic
1199888434 X:152047945-152047967 TAATTTTGTTAGAGAATATTAGG + Intergenic