ID: 1038632922

View in Genome Browser
Species Human (GRCh38)
Location 8:29262890-29262912
Sequence GGCCGCCGGACCCCCCACGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038632909_1038632922 8 Left 1038632909 8:29262859-29262881 CCTCGCGCCCCGCCGCTGACTAT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632914_1038632922 0 Left 1038632914 8:29262867-29262889 CCCGCCGCTGACTATAGGGGCGG 0: 1
1: 0
2: 1
3: 1
4: 25
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632908_1038632922 11 Left 1038632908 8:29262856-29262878 CCTCCTCGCGCCCCGCCGCTGAC 0: 1
1: 0
2: 4
3: 26
4: 250
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632907_1038632922 12 Left 1038632907 8:29262855-29262877 CCCTCCTCGCGCCCCGCCGCTGA 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632916_1038632922 -1 Left 1038632916 8:29262868-29262890 CCGCCGCTGACTATAGGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632904_1038632922 19 Left 1038632904 8:29262848-29262870 CCCGGGCCCCTCCTCGCGCCCCG 0: 1
1: 0
2: 4
3: 64
4: 613
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632919_1038632922 -4 Left 1038632919 8:29262871-29262893 CCGCTGACTATAGGGGCGGGGCC 0: 1
1: 0
2: 1
3: 3
4: 49
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632905_1038632922 18 Left 1038632905 8:29262849-29262871 CCGGGCCCCTCCTCGCGCCCCGC 0: 1
1: 0
2: 9
3: 138
4: 987
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632913_1038632922 1 Left 1038632913 8:29262866-29262888 CCCCGCCGCTGACTATAGGGGCG 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632906_1038632922 13 Left 1038632906 8:29262854-29262876 CCCCTCCTCGCGCCCCGCCGCTG 0: 1
1: 0
2: 0
3: 42
4: 404
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88
1038632903_1038632922 20 Left 1038632903 8:29262847-29262869 CCCCGGGCCCCTCCTCGCGCCCC 0: 1
1: 0
2: 1
3: 89
4: 721
Right 1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038632922 Original CRISPR GGCCGCCGGACCCCCCACGG CGG Intronic
900114816 1:1023981-1024003 GGCCACCGGACCCCCTGGGGTGG + Intronic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900472921 1:2863440-2863462 GGCCGCCAGTGCCCCTACGGTGG - Intergenic
900558535 1:3292028-3292050 GGCCGCAGGACCCCGCAGGAAGG + Intronic
900648123 1:3718139-3718161 GGCGGCCGGACCACCCACCCCGG - Intronic
901094173 1:6665020-6665042 GTCAGCTGGACCCCCCACAGAGG - Intronic
901818007 1:11805917-11805939 GGCCGCCGGCCGCACCACTGTGG + Intronic
902519037 1:17005435-17005457 CGCAGCCGCACCCCCCACAGGGG + Exonic
904264652 1:29311337-29311359 GGCCTCCTGAGCCCCAACGGGGG - Intronic
905168548 1:36097546-36097568 GGCAGCAGGACCCCCCCCGCGGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
915930798 1:160059730-160059752 GGCCGCTGGAAACCCCACAGGGG + Intronic
917930677 1:179820641-179820663 GGCAGCAGGGCCCCCCACAGGGG + Intergenic
917931090 1:179823401-179823423 GGCAGCAGGGCCCCCCACAGGGG + Intergenic
923684192 1:236142590-236142612 GGCCGCCGCCGCCCCCGCGGGGG - Exonic
1067399963 10:45962851-45962873 GGCAGCCGGATCCCACACTGAGG + Intergenic
1067806861 10:49398413-49398435 GGCGGCCGGACTCTCCTCGGGGG - Intergenic
1067868293 10:49932140-49932162 GGCAGCCGGATCCCACACCGAGG + Exonic
1075709358 10:124522396-124522418 TGGCACAGGACCCCCCACGGAGG - Intronic
1076737432 10:132465098-132465120 GGCAGCAGGTCCCCCCACAGGGG + Intergenic
1077505604 11:2928768-2928790 GGGCGCCGGGTCCCCCAAGGAGG + Intronic
1083333669 11:61910946-61910968 GGCTGCCGGCCCTCCCATGGGGG + Intronic
1084310154 11:68312350-68312372 GGCCGCCGGGCCCCGCGGGGCGG + Intergenic
1084403784 11:68959732-68959754 AGCCGTCGGACCCCACACGAGGG + Intergenic
1085294829 11:75425479-75425501 GGCCGCCGCGCCCCTCCCGGAGG - Exonic
1092260550 12:6951383-6951405 GGCCGCCTCACCACCCCCGGTGG - Exonic
1097170710 12:57111095-57111117 GGCCCCCGCACCCACCTCGGAGG + Intronic
1101910479 12:108857375-108857397 GGCCGCCGGACGCCGCGCCGAGG - Intronic
1102563419 12:113778958-113778980 GGAAGCCGGAGCCCCCATGGGGG - Intergenic
1105859443 13:24395663-24395685 GGCCAGCTGACCCCCCATGGTGG - Intergenic
1122847260 14:104506674-104506696 GGCCAGCTGACACCCCACGGTGG - Intronic
1127674814 15:61228953-61228975 GGCCGCCGGACCCCGCGCCCCGG + Intronic
1128159080 15:65411233-65411255 TGCCGCTGGACCCCCCACCAGGG - Exonic
1129644736 15:77419830-77419852 GGCCGCCAGAGCCCCGGCGGCGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132616260 16:842436-842458 GGCGGCTGGACGCCCCAGGGTGG + Intergenic
1132944901 16:2527421-2527443 GGCCGCCTGTCCCCTCACAGGGG - Intronic
1136541059 16:30927873-30927895 GCCTGCCGGGCCCCCCCCGGAGG + Exonic
1139594499 16:67950010-67950032 GGCGGCCTGAGCCCCCAAGGCGG - Intronic
1141660174 16:85437205-85437227 CGCCGCCGGGCTCCCCAAGGAGG + Intergenic
1141784930 16:86193205-86193227 GGCCGCCTGCCCTGCCACGGAGG - Intergenic
1141828619 16:86497516-86497538 CGCCTCCGGAGCCCCGACGGAGG + Intergenic
1143892287 17:10111736-10111758 GGCTGCCAGACCCACCAAGGAGG - Intronic
1151473356 17:74331396-74331418 TGCCCCAGGACCCCTCACGGTGG - Intronic
1153812271 18:8762649-8762671 GGCTGCCAGAACCCCCACAGGGG + Intronic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1160860630 19:1235992-1236014 TGCCACTGGACGCCCCACGGTGG - Exonic
1160989073 19:1853227-1853249 GGATGCCGGACCACCCATGGGGG + Exonic
1165922661 19:39308380-39308402 GGGCGCCGGATCCCCAGCGGTGG + Exonic
1166876559 19:45901455-45901477 GGGCGCCGGGCCCGCCGCGGAGG - Exonic
929573613 2:43038952-43038974 GGCCACCAGAGCCCCCAAGGGGG - Intergenic
935688857 2:105712304-105712326 GGCCACTGGAACCCCCAGGGGGG - Intergenic
938263318 2:129910202-129910224 GGCCTTGGGACCCCCCATGGGGG + Intergenic
944515736 2:200510036-200510058 GGCCGCCGGACGCCGCGGGGCGG + Exonic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
948423264 2:237873402-237873424 GGCAGCCGGGCCCCCCACAGGGG - Intronic
948817510 2:240520196-240520218 GGCTGTGGGACCCCCCACTGCGG + Intronic
949034558 2:241810558-241810580 GGCCCAGGGATCCCCCACGGAGG + Intronic
1169496749 20:6122965-6122987 TGCCTCGGGACCTCCCACGGAGG + Exonic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1185038402 22:48491116-48491138 GGGCGCCGGCGCACCCACGGTGG - Intronic
1185069509 22:48648319-48648341 GGCATCCGGAGCCCCCACAGGGG - Intronic
953902685 3:46852114-46852136 GGCCCCAGGACCGACCACGGAGG + Intergenic
954401260 3:50321093-50321115 GGGCAGCGGACCTCCCACGGCGG + Exonic
956675041 3:71725331-71725353 GGCCGCCGCGCCCCCCGCCGGGG - Exonic
968616555 4:1580249-1580271 GGCCGCCGAACCAACCGCGGAGG + Intergenic
974047279 4:56908365-56908387 GGCCGCCAGCCCCCGCCCGGCGG - Intronic
999286429 5:150396875-150396897 GGCTGCTGGGCACCCCACGGGGG + Intronic
1005959876 6:30687115-30687137 GGCCGCGGGACCCCCGGGGGAGG + Exonic
1007582255 6:42966521-42966543 GGCCGTTGGAGCCCCCAAGGTGG - Exonic
1007902039 6:45422010-45422032 GGCCGCCGCTCCCCCCGCGCGGG - Intronic
1019619808 7:1986404-1986426 TGCCGCCGGCCCCCGCACTGCGG + Intronic
1019689628 7:2403503-2403525 GGCCGCCGGAGGGGCCACGGAGG - Intergenic
1022410290 7:30134882-30134904 GGCCGCGCCAACCCCCACGGCGG + Exonic
1028762277 7:94509739-94509761 GGCATCCGGACCCCCCTCGCAGG + Intronic
1029423615 7:100483969-100483991 GGGCGCCGGCCCCCCCATGCCGG - Exonic
1032119977 7:129148623-129148645 GGCCGCCAGACCCACCACAGAGG - Intronic
1032215285 7:129952694-129952716 CGCCGCCGCCCCCCGCACGGGGG + Exonic
1035400085 7:158558993-158559015 GGCCTCTGGACCCCCCAGTGTGG - Intronic
1038632922 8:29262890-29262912 GGCCGCCGGACCCCCCACGGCGG + Intronic
1041076839 8:54176582-54176604 GGGCTCTAGACCCCCCACGGTGG + Intergenic
1059664917 9:116437522-116437544 GGCGGCCGGGCCGCCCACAGAGG - Intronic
1060660940 9:125404995-125405017 GGCCTTCAGACCCCCCACTGAGG + Intergenic
1060832000 9:126722834-126722856 GGCCGCCGGGCCCCGCCCTGGGG - Intergenic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1062584150 9:137241521-137241543 GGCCGCCGGGCCCCCTCCGCGGG + Intronic
1062696623 9:137879013-137879035 GGCCGGCAGACGCCGCACGGAGG - Intronic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1197962717 X:132023531-132023553 GGCCGCCGAACTACCCCCGGAGG + Intergenic
1198205409 X:134460416-134460438 GGCCGCCCGAGCCCGCACTGCGG - Intronic