ID: 1038635149

View in Genome Browser
Species Human (GRCh38)
Location 8:29280342-29280364
Sequence CCTACTAAGTAGGCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038635141_1038635149 8 Left 1038635141 8:29280311-29280333 CCGGGCATGATGATGCACGTCAG No data
Right 1038635149 8:29280342-29280364 CCTACTAAGTAGGCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038635149 Original CRISPR CCTACTAAGTAGGCTGAGGA GGG Intergenic
No off target data available for this crispr