ID: 1038637661

View in Genome Browser
Species Human (GRCh38)
Location 8:29300550-29300572
Sequence TTGTACACACCCCGCGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038637647_1038637661 16 Left 1038637647 8:29300511-29300533 CCCCCTGCCCCCGTATACTAGGA No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637659_1038637661 -8 Left 1038637659 8:29300535-29300557 CCATATCACAGGGGGTTGTACAC No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637644_1038637661 22 Left 1038637644 8:29300505-29300527 CCTCCTCCCCCTGCCCCCGTATA No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637643_1038637661 23 Left 1038637643 8:29300504-29300526 CCCTCCTCCCCCTGCCCCCGTAT No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637645_1038637661 19 Left 1038637645 8:29300508-29300530 CCTCCCCCTGCCCCCGTATACTA No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637652_1038637661 8 Left 1038637652 8:29300519-29300541 CCCCGTATACTAGGAACCATATC No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637654_1038637661 6 Left 1038637654 8:29300521-29300543 CCGTATACTAGGAACCATATCAC No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637650_1038637661 13 Left 1038637650 8:29300514-29300536 CCTGCCCCCGTATACTAGGAACC No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637649_1038637661 14 Left 1038637649 8:29300513-29300535 CCCTGCCCCCGTATACTAGGAAC No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637651_1038637661 9 Left 1038637651 8:29300518-29300540 CCCCCGTATACTAGGAACCATAT No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637648_1038637661 15 Left 1038637648 8:29300512-29300534 CCCCTGCCCCCGTATACTAGGAA No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data
1038637653_1038637661 7 Left 1038637653 8:29300520-29300542 CCCGTATACTAGGAACCATATCA No data
Right 1038637661 8:29300550-29300572 TTGTACACACCCCGCGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038637661 Original CRISPR TTGTACACACCCCGCGATAT GGG Intergenic
No off target data available for this crispr