ID: 1038644025

View in Genome Browser
Species Human (GRCh38)
Location 8:29348833-29348855
Sequence TTCCGCGCATTCTTCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038644025_1038644039 15 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644039 8:29348871-29348893 CGGAGGCGCAGCGCGGCGGGGGG No data
1038644025_1038644040 22 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644040 8:29348878-29348900 GCAGCGCGGCGGGGGGCGCCCGG No data
1038644025_1038644031 -8 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644031 8:29348848-29348870 GCGCGGAATGCGGCGGCGGGAGG No data
1038644025_1038644035 11 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644035 8:29348867-29348889 GAGGCGGAGGCGCAGCGCGGCGG No data
1038644025_1038644036 12 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644036 8:29348868-29348890 AGGCGGAGGCGCAGCGCGGCGGG No data
1038644025_1038644034 8 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644034 8:29348864-29348886 CGGGAGGCGGAGGCGCAGCGCGG No data
1038644025_1038644037 13 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644037 8:29348869-29348891 GGCGGAGGCGCAGCGCGGCGGGG No data
1038644025_1038644032 -5 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644032 8:29348851-29348873 CGGAATGCGGCGGCGGGAGGCGG No data
1038644025_1038644038 14 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644038 8:29348870-29348892 GCGGAGGCGCAGCGCGGCGGGGG No data
1038644025_1038644033 -2 Left 1038644025 8:29348833-29348855 CCCGCGCGGAAGAATGCGCGGAA No data
Right 1038644033 8:29348854-29348876 AATGCGGCGGCGGGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038644025 Original CRISPR TTCCGCGCATTCTTCCGCGC GGG (reversed) Intronic