ID: 1038644332

View in Genome Browser
Species Human (GRCh38)
Location 8:29350291-29350313
Sequence CCTCGCGCGCCCAGCCGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038644332_1038644345 21 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644345 8:29350335-29350357 CCTAGGCTGCAGAAAGGGGCGGG 0: 1
1: 0
2: 0
3: 40
4: 309
1038644332_1038644340 16 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644340 8:29350330-29350352 GGCCGCCTAGGCTGCAGAAAGGG 0: 1
1: 0
2: 1
3: 5
4: 120
1038644332_1038644336 4 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644336 8:29350318-29350340 GAAGAGAACCCGGGCCGCCTAGG 0: 1
1: 0
2: 0
3: 10
4: 93
1038644332_1038644335 -5 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644335 8:29350309-29350331 CGAGGAAGAGAAGAGAACCCGGG 0: 1
1: 0
2: 3
3: 77
4: 404
1038644332_1038644343 20 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644343 8:29350334-29350356 GCCTAGGCTGCAGAAAGGGGCGG 0: 1
1: 0
2: 1
3: 26
4: 338
1038644332_1038644341 17 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644341 8:29350331-29350353 GCCGCCTAGGCTGCAGAAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 164
1038644332_1038644339 15 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644339 8:29350329-29350351 GGGCCGCCTAGGCTGCAGAAAGG 0: 1
1: 0
2: 1
3: 13
4: 187
1038644332_1038644334 -6 Left 1038644332 8:29350291-29350313 CCGAGGCGGCTGGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 10
4: 145
Right 1038644334 8:29350308-29350330 GCGAGGAAGAGAAGAGAACCCGG 0: 1
1: 2
2: 43
3: 91
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038644332 Original CRISPR CCTCGCGCGCCCAGCCGCCT CGG (reversed) Exonic
901324972 1:8360489-8360511 CCTCGCCCGCCCAGCCCCCCGGG - Exonic
902214303 1:14924626-14924648 CCTCGCGCGCCCGGCCCCGGCGG - Intronic
904768958 1:32870589-32870611 CCTCTCGAGCCCAGCTACCTGGG - Intronic
904891025 1:33779713-33779735 TCTCTCGCTCCCAGCCCCCTTGG + Intronic
905647197 1:39633019-39633041 CCTCGCCCGCCCCGCCCCCGGGG - Intronic
907340432 1:53731469-53731491 CCTCTCCTTCCCAGCCGCCTGGG + Intronic
908355042 1:63320364-63320386 CCACGCGGGCCCAGCCACCAAGG + Intergenic
909075679 1:71047847-71047869 CCACGGGCGCCCCGCCCCCTCGG - Intergenic
911052338 1:93681566-93681588 CGCCGCGCGCCCAGCGTCCTCGG - Intronic
914888156 1:151600765-151600787 CCCCGCCCGGCCAGCCGCCCCGG + Intergenic
918282838 1:183023177-183023199 CCTCGCGCGCCCCTCCCCCCGGG + Intergenic
920029154 1:203026385-203026407 CCTCCCGCCCCCAAGCGCCTCGG - Intergenic
920314254 1:205066290-205066312 CCTTGCCCGCCCTCCCGCCTGGG + Intronic
920705108 1:208244665-208244687 CCTTGCGAGCCCAGCTGGCTTGG + Intergenic
921024045 1:211260543-211260565 CCTCGCTCGCCCCGGCGCCGAGG + Intronic
924948602 1:248863029-248863051 CCTGGCTGGCCCAGCTGCCTGGG + Intergenic
1064478868 10:15719933-15719955 GCCCGCCCGCCCAGCCGGCTCGG + Exonic
1065055449 10:21837928-21837950 CCCCGCCCGGCCAGCCGCCCCGG + Intronic
1065055472 10:21837974-21837996 CCCCGCCCGGCCAGCCGCCCCGG + Intronic
1066446894 10:35491845-35491867 CCTCGTGATCCCACCCGCCTCGG + Intronic
1067119932 10:43465068-43465090 CCCCGCCCGGCCAGCCGCCCCGG - Intronic
1074864057 10:117534951-117534973 CTTCCCGCGCCCAGACGCCGAGG + Intergenic
1075498798 10:122953801-122953823 CCTCTCACGCCCAGGAGCCTCGG + Intronic
1077090755 11:777271-777293 CCCGGCGCCCCCAGCGGCCTCGG + Intronic
1077107299 11:847810-847832 CTTCGCCCTCCCACCCGCCTGGG + Intronic
1077434237 11:2531103-2531125 CTTCGCCCTCCCAGCTGCCTGGG - Intronic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1077544971 11:3165243-3165265 CCCCGCGCGCCCGGCCGGCCCGG - Exonic
1080836425 11:35944539-35944561 CCGCGCGCGACCAGGCGTCTGGG - Intronic
1083611475 11:64006432-64006454 CCCCGGGCACCCACCCGCCTTGG - Intronic
1084000100 11:66291592-66291614 CCGCGAGCGCCCACCCACCTTGG + Intergenic
1084284255 11:68121292-68121314 CCCCGCGCGCCCAACCGCCGCGG - Intronic
1084504451 11:69556441-69556463 CCTCACTAGCCCAGCCACCTGGG + Intergenic
1084784813 11:71435901-71435923 GCTCGGGGGCCCAGCGGCCTGGG + Intronic
1089527637 11:119107626-119107648 CCCCGCGCGCCCAGCCCCGGGGG + Exonic
1091101225 11:132875694-132875716 CCTCAGGGGCCCACCCGCCTCGG + Intronic
1093435318 12:19129658-19129680 CCGCGCGCGCCCTACCCCCTCGG - Intergenic
1094811463 12:34142688-34142710 CCTCGTGGGCCCAGCCACCACGG + Intergenic
1095203734 12:39415488-39415510 CCTCGGCCTCCCAGCAGCCTCGG + Intronic
1096677113 12:53231930-53231952 GCTCGCCCGCCCCGTCGCCTGGG - Intronic
1097193175 12:57229960-57229982 CCACGCGCGCCCAGGGGTCTTGG - Intronic
1100048251 12:90411290-90411312 CCCCGCCCGGCCAGCCGCCCCGG + Intergenic
1101393344 12:104323380-104323402 CCCCGCCCGGCCAGCCGCCCCGG - Intronic
1112752619 13:102597406-102597428 CCTCGCCCGCCCAGCGACCCTGG - Intronic
1119357511 14:74019307-74019329 CCCCGCGCGCCGCGGCGCCTGGG + Exonic
1119643811 14:76334450-76334472 CCTCGCGCTCACAGCCGCCTGGG + Intronic
1119650091 14:76377133-76377155 CCGCGAGCGCAAAGCCGCCTCGG - Intronic
1122688675 14:103521631-103521653 CCCCGCGCCCACAGCGGCCTGGG - Intronic
1122838862 14:104444827-104444849 TCTCCCGCACCCAGCTGCCTTGG - Intergenic
1123491610 15:20785900-20785922 CATGGCGCGCGCAGCAGCCTTGG + Intergenic
1123548113 15:21354994-21355016 CATGGCGCGCGCAGCAGCCTTGG + Intergenic
1124626873 15:31312682-31312704 CCTGGCACGCCCAGCTGCCAGGG + Intergenic
1202956444 15_KI270727v1_random:82224-82246 CATGGCGCGCGCAGCAGCCTTGG + Intergenic
1132467549 16:84461-84483 CCTGGCCCTCCCAGCCACCTGGG - Intronic
1132547471 16:539978-540000 CCCAGCATGCCCAGCCGCCTGGG - Intronic
1132844044 16:1991897-1991919 CCTCGAGCGCCCACGCCCCTGGG - Intronic
1137244955 16:46694614-46694636 CCCCGCCCGGCCAGCCGCCCCGG - Intronic
1141725826 16:85787714-85787736 CCACGCACTCCCAACCGCCTTGG + Intronic
1141935389 16:87235000-87235022 CCTTTCGCTCCCAGCTGCCTAGG + Intronic
1142939805 17:3371799-3371821 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144770686 17:17757809-17757831 CCTCTCCCGCCCCGGCGCCTGGG - Intronic
1146935162 17:36808578-36808600 CCCCGCGCCCCCGGCTGCCTCGG - Intergenic
1148054191 17:44783952-44783974 CCTCGTGATCCCACCCGCCTCGG - Intergenic
1148664045 17:49361768-49361790 CCTAGCGCACGCAGCTGCCTCGG + Intronic
1148684741 17:49495188-49495210 GCCCGCCCGCCCTGCCGCCTCGG - Intergenic
1150624846 17:66835187-66835209 CCCCGCGCGCCCAGCCGGCGAGG + Exonic
1151946149 17:77321024-77321046 CCTCCCAGGCCCAGCCTCCTTGG + Intronic
1152386481 17:79977836-79977858 CCTCCCGTGCACAGCCGGCTGGG - Intronic
1152520203 17:80851617-80851639 CCTCGGGGGCCCACCTGCCTGGG - Intronic
1152926481 17:83090060-83090082 CCTCACGCGCCCAGGCCCCGGGG + Intronic
1157825045 18:50805022-50805044 CCTCGTGATCCCACCCGCCTCGG + Intronic
1158437142 18:57441577-57441599 CTTCGCGGACCCAGCCGCCCAGG - Intronic
1160397371 18:78582514-78582536 CGTCGGGCACCCAGCCACCTGGG - Intergenic
1160767697 19:815665-815687 CTTCGCGGCCCCTGCCGCCTCGG - Exonic
1160957247 19:1699394-1699416 CCTGGCGCTCCCACCCTCCTGGG + Intergenic
1161101751 19:2424985-2425007 CCTCGCGCGCCCCGCAGCTACGG + Exonic
1161790346 19:6355860-6355882 CCCCGCCCGGCCAGCCGCCTCGG + Intergenic
1162486012 19:10961019-10961041 GCGCGCGCGCCCGCCCGCCTCGG - Exonic
1162524098 19:11197533-11197555 CTTCGCGCGCGCCGCAGCCTGGG + Exonic
1162909767 19:13842589-13842611 CCTTGAGCGCCCCGCCGCCCGGG - Intergenic
1162954347 19:14090112-14090134 CGGCGCGCGTCCAGCCGCCCCGG - Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
1163630972 19:18417755-18417777 CCTCCCGCGCCGAGGCCCCTCGG + Intergenic
1163774796 19:19211864-19211886 CCTCGCGCAGCCAGAGGCCTCGG + Intergenic
1164298401 19:23937112-23937134 CCCCGCCCGGCCAGCCGCCCCGG - Intronic
1164298468 19:23937258-23937280 CCCCGCCCGGCCAGCCGCCCCGG - Intronic
1165842624 19:38797969-38797991 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1166304204 19:41928420-41928442 CCCCGCGCCCCCAGCCGGCCAGG - Intronic
1166689532 19:44814195-44814217 CCTCGCGTACCCAGCCTGCTGGG - Exonic
1167349558 19:48965948-48965970 CCTCGCGCGCACGGCCTGCTGGG - Intronic
1168721921 19:58558898-58558920 CCTCGGGCGCCCCGCCGCTTCGG + Exonic
927830505 2:26346075-26346097 CCGCGCACGCGTAGCCGCCTCGG - Intronic
929122944 2:38498337-38498359 CCTCGCCCAACCAGCTGCCTTGG - Intergenic
931602629 2:64019348-64019370 CCCCGCCGGCCCAGCCGGCTCGG + Intergenic
932798163 2:74715622-74715644 CCTCCCGCGCTCTCCCGCCTGGG + Intergenic
934031845 2:88055534-88055556 CCTCGCGCGCCCAGCCCGCCGGG - Intronic
934260973 2:91477361-91477383 CCCCCCGCCCCCCGCCGCCTCGG + Intergenic
936083766 2:109452887-109452909 CCTCCCGGGACCAGCCTCCTGGG - Intronic
936103568 2:109604491-109604513 CCTCGTGATCCCACCCGCCTCGG - Intronic
936513453 2:113167087-113167109 CCTCTCTCCCCCAGCCCCCTTGG - Intronic
936954811 2:118013564-118013586 ACTCCAGCGCCCAGCAGCCTCGG + Intronic
938406252 2:131034891-131034913 CCCCGCCCGCACAGCCGGCTTGG + Intronic
944533033 2:200683907-200683929 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1169113164 20:3046072-3046094 CTACGCGCGCTGAGCCGCCTGGG + Exonic
1169168138 20:3441373-3441395 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1171123624 20:22584584-22584606 CCGCGCGCTTCCCGCCGCCTCGG - Intronic
1172732426 20:37099201-37099223 CCTCGTGATCCCACCCGCCTCGG + Intergenic
1174346794 20:49936344-49936366 CCCCGCGAGCCCCGCCCCCTCGG + Intergenic
1175994289 20:62805295-62805317 CGTCCCGCCCCCAGCCGCCGTGG + Intronic
1176447014 21:6829942-6829964 CATGGCGCGCGCAGCAGCCTTGG - Intergenic
1184669074 22:46003428-46003450 CCTCCCGCGTCCGGCCTCCTGGG - Intergenic
1184673436 22:46027679-46027701 CCTCGCGGGCCCAGCTGGCCGGG - Intergenic
1185227337 22:49660481-49660503 CCTCGCCATCCCAGCCCCCTCGG - Intergenic
954393678 3:50280881-50280903 CCGCGCCCGGCCAGCCACCTTGG + Intronic
954456229 3:50601178-50601200 CCAGGCCTGCCCAGCCGCCTGGG + Intergenic
961365125 3:126394832-126394854 CCTCAAGCGCCCAGCCTCCGCGG + Intergenic
961518970 3:127456010-127456032 CCTGGCCCTCCCAGTCGCCTGGG + Intergenic
961962433 3:130868134-130868156 CCCCGCCCGGCCAGCCGCCCCGG + Intronic
964771105 3:160225363-160225385 CCTCTCGCGCCCAACCGCCCGGG - Intergenic
980053904 4:128061920-128061942 CCTCACGGGGACAGCCGCCTGGG - Intronic
989710346 5:44389526-44389548 CCTGGCGTTCCCAGCAGCCTAGG - Intronic
992312206 5:75511864-75511886 CGTCGCTCGCGCAGCCTCCTGGG + Exonic
992441210 5:76799226-76799248 GCCACCGCGCCCAGCCGCCTAGG - Intergenic
992837420 5:80654640-80654662 GCTCGCGCCCGCAGACGCCTGGG + Exonic
997645873 5:135481616-135481638 CGTCGCCAGCCCAGCAGCCTGGG - Intergenic
997899639 5:137753463-137753485 CGCCGCGCCCCCGGCCGCCTCGG + Exonic
1001488314 5:172136361-172136383 CCTCACGTGTCCACCCGCCTCGG - Intronic
1002888251 6:1313695-1313717 TCGCGCGCGCCCAGCCGCGCCGG - Exonic
1002981128 6:2139940-2139962 CCTCCTGCGCTCAGCTGCCTGGG - Intronic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1005347917 6:24908738-24908760 CCACCCGCCCCCAGCCTCCTTGG + Intronic
1013117785 6:107115483-107115505 CCGAGCGCGCCGGGCCGCCTGGG - Intergenic
1013580119 6:111525725-111525747 CCTCGTGATCCCACCCGCCTCGG - Intergenic
1013681274 6:112528314-112528336 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1018449844 6:163897396-163897418 CCTCGGGGGCTCACCCGCCTGGG - Intergenic
1019750260 7:2724810-2724832 TCTCACGCGCCCGGCAGCCTCGG - Intronic
1021313037 7:19116510-19116532 CCTCGCGCCCCCAGCGTCCCCGG - Intronic
1022092055 7:27114078-27114100 CCGCGCTTCCCCAGCCGCCTTGG - Intronic
1023703134 7:42912032-42912054 CCGCGCGAGCCCCGCCGCCTCGG + Exonic
1023864157 7:44230967-44230989 CCTTGCCCCCCCAGCGGCCTTGG - Intronic
1037769176 8:21789016-21789038 CCCCGCGCCGCCAGCCGCCTGGG - Intronic
1037817630 8:22120380-22120402 CCTCCCCAGCCCAGCAGCCTGGG - Exonic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1040622249 8:49103272-49103294 CCTCTCCGGCCCTGCCGCCTGGG - Intergenic
1041107685 8:54458464-54458486 GCCAGCGCGCCCGGCCGCCTGGG - Intronic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1045298659 8:100892634-100892656 CCCCGCCCGGCCAGCCGCCCCGG - Intergenic
1049191071 8:141287926-141287948 CCTCTTGCGCCCAGCCACCGAGG + Intronic
1049374307 8:142281728-142281750 CCCAGCGCCCCCACCCGCCTTGG - Intronic
1049674932 8:143885169-143885191 CCCAGCCCGCCCAGCCCCCTCGG + Intergenic
1061624724 9:131834995-131835017 CATCGCAGGCCCAGCGGCCTCGG + Intergenic
1203522176 Un_GL000213v1:54589-54611 CATGGCGCGCGCAGCAGCCTTGG + Intergenic
1189335716 X:40169775-40169797 CCTCCCTCGCCCAGCAGTCTCGG - Intronic
1192538681 X:71949993-71950015 TCTGGCGCTCCCAGCCGCCAGGG - Intergenic
1195954899 X:110318230-110318252 CCCCGCGCGCGCCCCCGCCTCGG + Exonic
1200087074 X:153612232-153612254 CCTCGTGATCCCCGCCGCCTTGG - Intergenic