ID: 1038644530

View in Genome Browser
Species Human (GRCh38)
Location 8:29351036-29351058
Sequence CAGCGCCCGGACTTTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038644516_1038644530 29 Left 1038644516 8:29350984-29351006 CCGAGGCCGAGAGGAAGAGGGAG No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644525_1038644530 -5 Left 1038644525 8:29351018-29351040 CCCGCCGCCAGCGGCGGGCAGCG No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644519_1038644530 23 Left 1038644519 8:29350990-29351012 CCGAGAGGAAGAGGGAGGCGGCC No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644524_1038644530 -1 Left 1038644524 8:29351014-29351036 CCGACCCGCCGCCAGCGGCGGGC No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644526_1038644530 -6 Left 1038644526 8:29351019-29351041 CCGCCGCCAGCGGCGGGCAGCGC No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644527_1038644530 -9 Left 1038644527 8:29351022-29351044 CCGCCAGCGGCGGGCAGCGCCCG No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data
1038644521_1038644530 2 Left 1038644521 8:29351011-29351033 CCTCCGACCCGCCGCCAGCGGCG No data
Right 1038644530 8:29351036-29351058 CAGCGCCCGGACTTTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038644530 Original CRISPR CAGCGCCCGGACTTTGTGAA TGG Intergenic
No off target data available for this crispr