ID: 1038645099

View in Genome Browser
Species Human (GRCh38)
Location 8:29354396-29354418
Sequence CTTGATGGGCAGAGGTACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038645099_1038645104 -4 Left 1038645099 8:29354396-29354418 CCTACGTACCTCTGCCCATCAAG No data
Right 1038645104 8:29354415-29354437 CAAGTCAGGACTGAAAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038645099 Original CRISPR CTTGATGGGCAGAGGTACGT AGG (reversed) Intergenic
No off target data available for this crispr